Topic 3: The chemistry of life

Slides:



Advertisements
Similar presentations
Transcription and Translation
Advertisements

3.4: Transcription and Translation
RNA and Protein Synthesis
RNA and Protein Synthesis
13.3: RNA and Gene Expression
RNA Transcription.
PROTEIN SYNTHESIS.
DNA Replication.
The Structure of RNA RiboNucleic Acid
DNA Biology Lab 11. Nucleic Acids  DNA and RNA both built of nucleotides containing Sugar (deoxyribose or ribose) Nitrogenous base (ATCG or AUCG) Phosphate.
Trait Chapter 12 Section 3. Ribonucleic acid Responsible for the movement of genetic information from the DNA in the nucleus to the site of protein.
Do Now: Do Now: 1. What structure makes proteins? 2. Where are these found? 3. Where is DNA stored? 4. Why not in cytoplasm? Homework: read 12-3 and complete.
Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
RNA and PROTEIN SYNTHESIS Chapter 13-1 & 13-2
Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.
DNA, RNA, and Proteins Section 3 Section 3: RNA and Gene Expression Preview Bellringer Key Ideas An Overview of Gene Expression RNA: A Major Player Transcription:
RNA and Protein Synthesis
Protein Synthesis Process that makes proteins
12-3 RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS
Structure and functions of RNA. RNA is single stranded, contains uracil instead of thymine and ribose instead of deoxyribose sugar. mRNA carries a copy.
Core Transcription and Translation
Leaving Cert Biology Genetics – section 2.5 Genetics ( RNA), 2.5.5,
Chapter 15: Protein Synthesis
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
I.Structure and Function of RNA A) Why is RNA needed? 1) proteins are made by ribosomes outside the nucleus (on the rough Endoplasmic Reticulum)
Molecules to Eye Color DNA, RNA and Protein Synthesis.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Molecules to Eye Color DNA, RNA and Protein Synthesis.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
Watch the animation and complete the card sort.
Section 20.2 Gene Expression
Genetics: RNA and Protein Synthesis
Notes: Transcription DNA vs. RNA
Protein Synthesis Przeworski.
PROTEIN SYNTHESIS.
RNA Ribonucleic Acid Single-stranded
Protein Synthesis.
PROTEIN SYNTHESIS CHAPTER 10 section 4
Section 3: RNA and Gene Expression
Protein Synthesis.
How to Make a Protein?.
Protein Synthesis.
Protein Synthesis.
DNA vs RNA.
Protein Synthesis.
BIOLOGY NOTES GENETICS PART 7 PAGES
PROTEIN SYNTHESIS.
Protein Synthesis Standards:
To explain the process of protein synthesis.
Protein Synthesis.
BIOLOGY NOTES GENETICS PART 7 PAGES
Transcription and Translation
Chp: 12 Transcription & Translation
Transcription and Translation
BIOLOGY NOTES GENETICS PART 7 PAGES
TRANSCRIPTION & TRANSLATION
Protein Synthesis Standards:
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Molecular Basis of Heredity
RNA - TRANSLATION.
GENE EXPRESSION / PROTEIN SYNTHESIS
BIOLOGY NOTES GENETICS PART 7 PAGES
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
An Overview of Gene Expression
Protein Synthesis.
12-3 RNA & Protein Synthesis
Protein Synthesis.
Presentation transcript:

Topic 3: The chemistry of life 3.5 Transcription and translation IB Biology SFP - Mark Polko

IB Biology SFP - Mark Polko ASSESSMENT STATEMENTS 3.5.1 Compare the structure of RNA and DNA. 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand complementary to the DNA strand by RNA polymerase. 3.5.3 Describe the genetic code in terms of codons composed of triplets of bases. 3.5.4 Explain the process of translation, leading to polypeptide formation. 3.5.5 Discuss the relationship between one gene and one polypeptide. IB Biology SFP - Mark Polko

Deoxyribonucleic acid 3.5.1 Compare the structure of RNA and DNA. Deoxyribonucleic acid Ribonucleic acid Shape Double helix Single helix Sugar Deoxyribose Ribose Bases A,T,C,G A,U,C,G Ribosomal RNA (rRNA ) which is a major component of ribosomes Transfer RNA (tRNA) which is folded upon itself and carries amino acids to mRNA Messenger RNA (mRNA) which consists of a sequence of nucleotides that determines the primary sequence of a polypeptide. Three main kinds of RNA are commonly found in cells: IB Biology SFP - Mark Polko

IB Biology SFP - Mark Polko 3.5.2 Outline DNA transcription in terms of the formation of an RNA strand complementary to the DNA strand by RNA polymerase. The process of protein (or polypeptide) synthesis can be divided into two parts: Transcription: the process by which RNA is produced from a DNA template. Translation: the assembly of a polypeptide in a sequence specified by the order of nucleotides in the mRNA. Transcription is similar to DNA replication in that it takes place in the nucleus and involves a section of DNA which needs to unzip. Then only one of the two strands of DNA is transcribed (the ’anti-sense’ strand) and a complementary RNA strand to this strand is made. This is called messenger RNA (mRNA) and it has the same sequence of nucleotides, except for U instead of T, as the sense strand of the DNA (the strand that is NOT transcribed). After transcription, the mRNA leaves the nucleus through the pores in the nuclear envelope and goes into the cytoplasm. LINK IB Biology SFP - Mark Polko

IB Biology SFP - Mark Polko 3.5.3 Describe the genetic code in terms of codons composed of triplets of bases. The genetic code is based on sets of 3 nucleotides called codons. Since 20 amino acids are commonly found in cells, it is not possible to have 4 different nucleotide codes for all of them. If we tried using a set of 2 nucleotides, we could create 42 = 16 different combinations, which is insufficient for the 20 different amino acids. So, therefore, we need to use a set of 3 nucleotides which will create 43 = 64 possibilities. This is more than is required for the 20 different amino acids. As a result, the code is said to be degenerated, meaning that more than one codon can code for a single amino acid. The sequence of the codons in the mRNA determines the sequence of the amino acids in the polypeptide. IB Biology SFP - Mark Polko

IB Biology SFP - Mark Polko 3.5.3 Describe the genetic code in terms of codons composed of triplets of bases. Here are some examples: IB Biology SFP - Mark Polko

IB Biology SFP - Mark Polko 3.5.4 Explain the process of translation, leading to polypeptide formation. After the mRNA has reached the cytoplasm, translation takes place. In the cytoplasm, ribosomes attach to the mRNA. The ribosome covers an area of three codons on the mRNA. The first tRNA carrying an amino acid will come in and the anti-codon exposed on the tRNA will have complementary binding with the codon of the mRNA in the A site of the ribosome. The ribosome will move and the first tRNA will be in the P site on the ribosome. LINK IB Biology SFP - Mark Polko

IB Biology SFP - Mark Polko 3.5.4 Explain the process of translation, leading to polypeptide formation. The second tRNA with its own anti-codon, and consequently carrying a specific amino acid, will complementary bind to the second codon on the mRNA, filling the A site in the ribosome. The second amino acid will attach to the first (formation of a peptide bond by a condensation reaction) and the first amino acid will be released from the first tRNA. The ribosome will move in relation to the mRNA. The first tRNA (without amino acid) is now found in the E site of the ribosome. The second tRNA will be in the P site and the A site is empty. (Please use the animation on the website to understand this process better) IB Biology SFP - Mark Polko

IB Biology SFP - Mark Polko 3.5.4 Explain the process of translation, leading to polypeptide formation. The anticodon of the third tRNA will bind to the third codon of the mRNA in the A site of the ribosome. The anticodon of first tRNA (without its amino acid) will dissociate from the first codon of the mRNA in the E site of the ribosome. The second amino acid will form a peptide bond with the third amino acid and the second amino acid will be released from the second tRNA. The ribosome will move so that the second tRNA (without amino acid) will now occupy the first site of the ribosome. The second site is occupied by the third tRNA, which has a chain of three amino acids attached. The third site is free and the next tRNA will come in, carrying its own amino acid. This process continues until a STOP codon is reached. The STOP codon does not code for an amino acid but terminates translation. IB Biology SFP - Mark Polko

IB Biology SFP - Mark Polko

IB Biology SFP - Mark Polko 3.5.5 Discuss the relationship between one gene and one polypeptide. The ‘one gene – one polypeptide’ concept means that every polypeptide chain is coded for by one gene. It also means that a gene only codes for one polypeptide chain. Haemoglobin contains four polypeptide chains, 2 alpha chains and 2 beta chains. To make a haemoglobin therefore requires 2 genes: one for the alpha chains and one for the beta chains. It can be assumed that every biological reaction is catalysed by enzymes and does not occur without them. The presence or absence of the enzyme will decide if the reaction takes place. So if you have the allele for brown eyes, it means that you have the allele that makes the enzyme which catalyses the reaction which makes brown pigment. You therefore make the brown pigment. You do not have the allele for the enzyme which makes the blue Pigment. (Or you do but it is recessive and won’t be expressed) IB Biology SFP - Mark Polko

Topic 3: The chemistry of life 3.5 Transcription and translation IB Biology SFP - Mark Polko