The Human Genome Project DVD: “DNA: the secret of life” chapter 7 Human Genome Project (pbslearningmedia.org) As you view the clips, fill in your notes about the Human Genome Project.

Human Genome Project Did you get it? A worldwide effort to sequence and identify every gene of the human genome. The outcome was a map of all human chromosomes with every gene’s DNA sequence and every human trait.

2. Why was the HGP established? To provide genetic information (a database) to use to help cure/treat/prevent genetic diseases (ie. Gene therapy).

GENE THERAPY: What is it? A technique involving Inserting a normal or healthy gene into a cell to replace a faulty/defective gene. BIG PICTURE: The process of identifying “bad” disease genes and replacing them with “good” working genes.

THE BIG PICTURE: How does Gene Therapy Work? If a person’s gene is defective (has a mutation) or is missing, then a problem results. To fix this problem, if scientists can identify the gene (using information from the Human Genome Project), then they can inject a copy of the working gene into the patient using a virus. The viruses infect cells and inject the gene. Now the person has good copies of the gene and will start producing working proteins (hormones, enzymes, etc).

2. How does Gene Therapy Work? Use a virus to deliver the correct version of the gene to the cell. Then the cell has the correct version of the gene. The gene will then be used to make the correct protein for the individual.

3. What are viruses? Viruses are Non-living things with genes inside. They inject DNA into a cell. The virus serves as a vector. A vector is a vehicle for moving genes.

Viruses are a TOOL for Gene Therapy! Made only of nucleic acids and a protein coat. Must have a host cell to reproduce.

4. What are two disorders that involve defective genes? Cystic Fibrosis – an inherited disease that causes the body to make the incorrect protein that codes for the body to make thick sticky mucous, which builds up in the lungs and digestive system; infections can lead to early death Severe Combined Immunodeficiency Syndrome (SCIDs) – a faulty gene affects a person’s ability to fight off infectious diseases; severely weakens the immune system; can lead to early death

5. What are BENEFITS of Gene Therapy? Helps cure diseases at the genetic level.

6. What are CONCERNS of Gene Therapy? Viruses may not insert the gene into the DNA properly. The technology is expensive and only accessible to the rich. “Playing God”

Gene Therapy Videos! How does Gene Therapy Work? (2:27) Alzheimer’s Disease (PBS) (2:49) Finding Cures is Hard (PBS) (8:08)

Gene Therapy Reading READ “Healing Through Gene Therapy” and highlight key terms. Answer the questions. Turn this in.

Stem Cells Ted Talks- Stem Cells (15 Min) Nova Stem Cells- Ethics Nova Stem Cell Breakthrough- Making Stem Cells

STEM CELLS: Making a new Heart?! Stem Cells- New Heart

1. What are STEM CELLS? Unspecialized and undifferentiated cells Do not have a specific job/function in the body yet. Have the ability to become almost ANY cell in the body

2. What are the TWO MAIN TYPES of stem cells? EMBRYONIC stem cells Are the cells that form/come from the embryo (fertilized egg) and are essential in the development of life They are very plastic and flexible and have the potential to become a wide variety of cells in the body Most useful in stem cell research Most controversial….why?

WHY is it more CONTROVERSIAL? Embryonic stem cells come from embryos (first cells of a baby) Using embryonic cells is controversial because it is believed that it could be ending a potential life.

WHY is it more CONTROVERSIAL? The embryonic stem cells are being taken from a fertilized egg and sperm. If the stem cells are removed from the embryo the embryo will NOT be able to survive. If the embryo is left alone, it will develop into a child. It is believed that taking the cells from an embryo kills a potential life.

2. What are the TWO MAIN TYPES of stem cells? Adult stem cells Cells that are present throughout life (found in bone marrow and a few other places) that help to generate new cells throughout life Are less unspecialized and have the potential to become only a few different types of cells Less controversial…why?

3. What are the USES/BENEFITS of stem cell research? potential to curing disease (such as SCID and cystic fibrosis) Use to replace worn out or damaged cells/tissues/organs. Used to create new organs or tissues in the body.

4. What are CONCERNS of stem cell research? ESC destroys an embryo (fertilized egg and sperm) and thus prevents a potential life. Potential to cause disease (like cancer) if the cells are programmed incorrectly. “Playing God”

Videos – Google search for… Stem Cells: Seeds of Hope NOVA scienceNOW: Stem Cells Breakthrough (fast forward to 25:55) Watch the videos on ONE COMPUTER in your groups and then TOGETHER discuss what you viewed. Be prepared for a whole class discussion afterwards.

Stem Cells: Seeds of Hope What does Dr Snyder mean when he says stem cells are "flexible and plastic?" In this video what evidence convinces you that stem cells can be used to cure spinal cord injury? Dr Snyder points out that there are ethical concerns, and that there is no single answer that will please everyone. Who do you think should be the ones to decide where to obtain stem cells for medical research?

Cloning…what is it? Let’s view a video to get some details “Does Human Cloning Already Exist?”

1. What is Cloning? Creating new and identical organisms or tissues using biotechnology (making an exact copy!) Cloning produces offspring that are genetically identical to the parent. Do clones exist in nature?

2. What are the STEPS to create a CLONE? An egg is taken from a donor cell and the nucleus is removed. The (donor) egg cell is fused with a cell from another adult (this contains the desired nucleus/DNA to be cloned). When they fuse, the cell begins to divide until it forms an embryo. The embryo is then placed into a female surrogate (foster mother). The embryo grows and develops until it is born ; it is genetically identical to the donor nucleus.

3. What are the BENEFITS/USES of cloning? Help endangered species recover Produce organisms with medical benefits (like creating donor organs) Creating tissues for transplants and cures for diseases

4. What is the CONCERN of cloning? Fear of cloning humans. (is it ethical?) “Playing God” (just because we can, should we?)

5. Who is DOLLY? What happened to her? Dolly is (was) a sheep and was the first cloned animal (from an adult cell). All clones before that came from embryos. Dolly suffered from many health issues and died at an early age.

How Was Dolly Cloned? Did you get it? Answer Questions 1-6 A B C

Human Cloning Video (2:54)

Gel Electrophoresis The process: (Basic Steps) Extract DNA Cut DNA (using restriction enzymes) Put DNA fragments in Gel Separate DNA by size using electric charge Analyze DNA fragments (DNA Fingerprint)

Detailed Steps a) The process of gel electrophoresis works to separate DNA fragments according to their length/size

Detailed Steps b) In order to cut the DNA into fragments, restriction enzymes are used. These are specific proteins (type of organic molecule) that “recognize” specific sequences of DNA and then cut it in half.

Detailed Steps c) Samples of the DNA fragments are loaded onto a gel and the electricity is turned on. (hence the name: gel electrophoresis!)

Detailed Steps d) DNA fragments move through the gel due to opposite charges. The shorter/smaller strands move farther down the gel than the longer/larger strands. Since they are larger and heavier, they do not move as far down the gel.

Detailed Steps e) The groups of DNA fragments show up as small lines (called bands) in the gel.   f) Now a DNA FINGERPRINT is created, which can be analyzed!

Uses for DNA Fingerprints (and the gel electrophoresis process) Identify a person or suspect in a crime Determine the parents of a child Identify and catalogue endangered, new, or extinct species Determine evolutionary relationships of species

Where do scientists obtain DNA to be analyzed? Any cell! DNA is found in blood, hair, skin, saliva, bones, and more!

Gel Electrophoresis Simulation http:learn.genetics.utah.edu/content/labs/gel/

A Closer Look at RESTRICTION ENZYMES 1. What is the role of the restriction enzymes in gel electrophoresis? Cut DN A at specific sequences

A Closer Look at RESTRICTION ENZYMES 2. In order for DNA to be transferred from one source to another, the DNA must be cut with restriction enzymes to allow for transfer. The following is a segment of DNA that needs to be cut with the restriction enzyme BAM1. The BAM1 cuts at the following restriction site between the G and T. 2

How to Analyze a DNA Fingerprint DNA Fingerprints can be used to determine paternity of a child. Each DNA band in the child must match up to either the Mom or the Dad. Which male is the father of this child?

How to Analyze a DNA Fingerprint DNA Fingerprints can be used to match crime scene DNA to suspects. For this type of analysis, the DNA must be an exact match. Which suspect was at the crime scene?

How to Analyze a DNA Fingerprint DNA Fingerprints can be used to identify unknown species or compare how related 2 species are. For this type of analysis, find the species with the most similarities. Which two species are most closely related?

Activity: Modeling DNA Fingerprinting Read the introduction. Gather materials: scissors, ruler, paper strip I will model Part A for you first

Watch me first! My DNA Sequence Strip

ACAGAGCACTATATATATACCGCGC Watch Me! My DNA Sequence Strip ACAGAGCACTATATATATACCGCGC

When you finish… Turn in your lab sheet! Return your class materials Pick up a DNA Fingerprint Practice Worksheet and complete it. Check those answers at the SSS!

POGIL Activity: Genetically Modified Foods Work in groups of 4. On your sticky note, write down the names and roles of each member. MANAGER READER RECORDER REPORTER At the end of the activity, 1 paper from each group will be collected and graded.

Genetic Engineering, Recombinant DNA, Transgenic Oranisms Complete the Vocabulary Section Get a green NC Coach book and complete the reading/fill-in-the-blanks When you finish, check all your answers at the SSS!

Recap…What is RECOMBINANT DNA? Combined DNA from 2 different organisms (often a plasmid)

What is a TRANSGENIC ORGANISM? It is an organism that has had genes transferred (or moved into) it from a different organism. Transgenic organisms are made from recombinant DNA.

What is a GENETICALLY MODIFIED FOOD/ORGANISM (GMO)? It is a crop or food that has been genetically altered or changed. This means it contains recombinant DNA! Examples?

What are some USES for transgenic organisms and GMOs? Improve human health  scientists can use transgenic bacteria to produce large amounts of human proteins such as human growth hormone and insulin. What type of people are helped by this application of genetic engineering? Diabetics Improve food production  crops can be genetically engineered to grow larger and faster, resist disease, and resist drought or frost.

How HUMAN INSULIN is genetically engineered

What are some CONCERNS about GMOs? May spread diseases or carry toxins May contribute to allergies Spread unwanted genes into the environment

Video: Bt Corn “Evolution Bt Corn Genes and Bug Genes” While you watch, consider/answer the 3 questions on your paper.

Video: Super Salmon PBS Learning Media As you watch, consider/answer the 4 questions on your paper

Practice Complete the front side of the worksheet When you FINISH, check your work at the SSS Ask if you don’t understand something!