CHU Ulg Liège, Centre for Human Genetics Acquired alterations of IG and TCR loci in lymphoproliferative disorders Sabine Franke, PhD Sabine.Franke@chu.ulg.ac.be CHU Ulg Liège, Centre for Human Genetics Interuniversity course 2017/18 - HUMAN GENETCIS 20. April 2016 ULG

Overview What are lymphoproliferative disorders? What are ‘IG’ and ‘TCR’? What are IG/TCR alterations? How to detect IG/TCR alterations?

Overview What are lymphoproliferative disorders? What are ‘IG’ and ‘TCR’? What are IG/TCR alterations? How to detect IG/TCR alterations?

Blood cell development major types of lymphocytes

Three major types of lymphocytes B cells T cells Natural killer (NK) cells Origin lymphoproliferative disorders

Function of B and T cells B cells are primary responsible for humoral immunity (relating to antibodies) T cells are involved in cell-mediated immunity. B cells play a large role in the adaptive immune system by making antibodies to identify and neutralize bacteria and viruses. Protection of the body by …

B-cells Millions of different types of B cells each day In the blood and lymphatic system role of immune surveillance No production of antibodies until fully activated The human body makes millions of different types of B cells each day. They circulate in the blood and lymphatic system performing the role of immune surveillance. B-cell circulate in the blood and lymph but are not producing antibodies. They need a signal to differenciate further They do not produce antibodies until they become fully activated.

1) Combinatorial diversity (Somatic recombination) 2) Junctional diversity (Inaccurate junction) 3) Somatic hypermutation (Affinity maturing in germinal centres) B cells are produced in the bone marrow. B cell development occurs through several stages Three B-cell-specific DNA remodelling mechanisms that modify immunoglobulin (Ig) genes are involved at different stages of B-cell development135: VDJ recombination, somatic hypermutation and Ig heavy chain (IgH) switch recombination. Sequential and regulated VDJ recombination assembles combinations of the many Ig V, D and J segments in precursor bone-marrow B cells to create Ig heavy chain (H)/Ig light chain (L) antigen receptors. A D segment combines with a J segment and then a V segment combines with this DJ segment to form a unique IgH VDJ sequence in pro-B cells; then, V and J segments combine to form a unique IgL VJ sequence in pre-B cells; additional joining of V and J segments occurs as part of receptor editing in self-reactive immature B cells. Immature B cells that express functional surface IgM exit the bone marrow and home to secondary lymphoid tissues as mature B cells. Productive interaction of mature B cells with antigen results in proliferation and differentiation. The primary immune response generates pre-germinal-centre plasma cells that typically are short lived, and usually secrete IgM but can secrete other Ig isotypes as a result of IgH switch recombination116, 117, 136. Germinal centres are generated during the primary immune response. Antigen-activated lymphoblasts that enter a germinal centre are subjected to multiple rounds of somatic hypermutation of IgH and IgL V(D)J sequences and antigen selection. Cells that express high-affinity antigen receptors are selected for survival, with subsequent differentiation to memory B cells or post-germinal-centre plasma cells. Post-germinal-centre plasmablasts/plasma cells (including those generated from memory B cells) that undergo IgH switch recombination typically home to the bone marrow, where they reside as terminally differentiated, non-proliferating, long-lived plasma cells for >30 days but sometimes years. Nearly 80% of B-cell tumours arise from germinal-centre or post-germinal-centre B cells120, indicating that the intrinsic genetic instability of B cells that is unleashed in the germinal centre is important for their development. Although somatic hypermutation can cause mutations in some non-Ig genes137, 138, it is unclear if the germinal-centre environment is responsible for any oncogenetic changes other than primary Ig translocations. Multiple myeloma cells are the transformed counterparts of post-germinal-centre bone-marrow plasmablasts/plasma cells (reviewed in Refs 66,139). B cells: plasma B cells and memory B cells. The B cell may either become one of these cell types directly or undergo an intermediate differentiation step, the germinal center reaction, where the B cell will hypermutate the variable region of its immunoglobulin gene ("somatic hypermutation") and possibly undergo class switching.

of the antigen receptor genes occur during the lymphoid proliferation Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation In detail later

Lymphoproliferative disorders (LPDs) LPDs refer to several conditions in which lymphocytes are produced in excessive quantities. Chronic lymphocytic leukemia (most frequent) 25% Acute lymphoblastic leukemia Hairy cell leukemia lymphomas Multiple myeloma Waldenstrom’s macroglobulinemia Wiskott-Aldrich syndrome Post-transplant lymphoproliferative disorder Autoimmune lymphoproliferative syndrome (ALPS) ‘Lymphoid interstitial pneumonia’ The most frequent disorders in which lymphocytes are produced in excessive quantities. Here is one kind of cell excessive present. These are the malignancies of the lymphsystem. CLL most frequent in adults

B, T, and NK lineage of lymphoid malignancies Lymphoid malignancy B lineage T lineage NK lineage Acute lymphoblastic leukemia – children 82 – 86% 14 – 18% < 1% – adults 75 – 80% 20 – 25% < 1% Chronic lymphocytic leukemias 95 – 97% 3 – 5% 1 – 2% Non-Hodgkin lymphomas – nodal NHL 95 – 97% 3 – 5% < 2% – extranodal NHL 90 – 95% 5 – 10% < 2% – cutaneous NHL 30 – 40% 60 – 70% < 2% Multiple myeloma 100% 0% 0% B, T, and NK lineage of lymphoid malignancies

1.Take home message Three major types of lymphocytes In LPDs lymphocytes are produced in excessive quantities Different lymphoid malignancies of different lineage origin

Overview What are lymphoproliferative disorders? What are ‘IG’ and ‘TCR’? What are IG/TCR alterations? How to detect IG/TCR alterations?

Image source: Immunobiology, 5th edition Janeway et al B-cell and T-cell receptors Each B cell has a unique receptor protein (referred to as the B cell receptor (BCR)) on its surface that will bind to one particular antigen. Image source: Immunobiology, 5th edition Janeway et al

Structure of the B-cell receptors The antibody is composed of two light (L) and two heavy (H) chains The BCR is a membrane-bound immunoglobulin, and allows the distinction of B cells from other types of lymphocytes and is the main protein involved in B cell activation.

The ability to produce billions of different antibodies in humans results from the production of variable regions of light and heavy antibody genes by DNA rearrangement. Heavy chain (IGH) Light chain (IGL) The five major classes of heavy chain are IgM, IgG, IgA, IgD, and IgE. Every chain has a variable and a constant domain. The variable domains develop the antigen http://www.biology.arizona.edu

Schematic representation of an Immunoglobulin (IG) In the H chain loci there are 3 regions V,D,J which combine ramdomly to produce a unique variable domain in the IgH of each individual B cell. Similar rearrangements occur for L chain locus V,J

Image source: Immunobiology, 5th edition Janeway et al Structur of the T-cell receptor Image source: Immunobiology, 5th edition Janeway et al

T-cell receptor gene rearrangement The variable domain of both the TCR α-chain and β-chain have three hypervariable or complementary determining regions (CDRs) Receptor for antigen on the majority of mature T-cells consists of two polypeptides alpha and beta that are linked by disulphide bonds and are associated with CD3 A small population of mature T-cells express a different TCR heterodimer in association with CD3. This is composed of two polypeptides designated gamma and delta

2. Take home message Structure of the B and T cell receptor is important Ig and TCR consists of a variable and a constant region Ig consists of heavy and light chains

Overview What are lymphoproliferative disorders? What are ‘IG’ and ‘TCR’? What are IG/TCR alterations? How to detect IG/TCR alterations?

The production of variable regions of light and heavy antibody genes by DNA rearrangement. Process of Ig formation at the different stages of B cell development H chain D-J V-DJ H chain is rearranged VJ VJ chain L rearranged When B cells fails in any step, it will die =apoptosis Only portion of cells survive to participate in the long-lived peripheral B cll pool

The production of variable regions of heavy antibody genes by DNA rearrangement. stepwise rearrangement of V, D, and J gene segments Genes encoding antigen receptors are unique: high diversity developing lymphocytes through V(D)J rearrangement.

These V-J gene rearrangements generate products that are unique in length and sequence in each cell resulting in diverse antigen expressing B cells.

B cell development

Cell development. Stage Heavy chain Light chain Progenitor (or pre-pro) B cells germline Early Pro (or pre-pre)-B cells undergoes D-J rearrangement Late Pro (or pre-pre)-B cells undergoes V-DJ rearrangement Large Pre-B-cells is VDJ rearranged Small Pre-B cells undergoes V-J rearrangement Immature B cells VJ rearranged Mature B cells

T cell rearrangement

Estimated diversity of human Ig and TCR molecules IgH Igα Igג TCR α β γ δ molecules molecules Number gene segments V gene segments ~44 ~43 ~38 ~46 ~47 ~6 ~6 D gene segments 27 2 3 J gene segments 6 5 4 53 13 5 4 Combination diversity >2x10 6 2x10 6 <5000 Junctional diversity ++ + + + ++ ++ ++++ Total diversity >10 12 >10 12 >10 12

Possible variation through recombining gene fragments? Over 15,000,000 combinations of variable, diversity and joining gene segments are possible. Imprecise recombination and mutation increase the variability into billions of possible combinations. So how much variation is possible through recombining gene fragments?

3. Take home message Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation B-cells: Stepwise rearrangement of V, D, and J gene segments Unique products of V(D)J rearrangements resulting in diverse antigen expressing B-cells

Overview What are lymphoproliferative disorders? What are ‘IG’ and ‘TCR’? What are IG/TCR alterations? How to detect IG/TCR alterations?

Clinically relevant testing B-cell versus T-cell malignancy (origine) Reactive versus malignant New lymphoma versus recurrence Assessment of remission and relapse Bone marrow involvement Evaluation of treatment effectiveness

Analysis Techniques Detecting gene rearrangements of the antigen receptor genes Discrimination between monoclonal and polyclonal Ig/TCR gene PCR products

PCR Discrimination between monoclonal and polyclonal Ig/TCR gene PCR products GeneScanning analysis Fast, accurate, sensitive non-quantitative monitoring of clonal proliferations Need sequence equipment Heteroduplex analysis Sensitivity ~5-10% available to most laboratories

Ig genes: IGH: VH-JH and DH-JH Design of novel primer sets for detection of Ig/TCR rearrangements BIOMED-2 study (multiplex PCR) Ig genes: IGH: VH-JH and DH-JH IGK: V-J and Kde rearrangements IGL: V-J TCR genes: TCRB: V-J and D-J TCRG: V-J TCRD: V-J, D-D, D-J, and V-D

BIOMED-2 clonality strategy Suspected B-cell lymphoma Suspected lymphoma of unknown origin Suspected T-cell lymphoma TCRGVJ (A and B) TCRB V(D)J (A and B) TCRB DJ IGH V(D)J FR1, FR2, FR3 IGH DJ(A) IGK-VJ and DE

CTGTGCAAGAG Van Dongen et al Leucemia 2003 Lymphocyte population derived from one single cell. CTGTGCAAGAG CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG ……….. Van Dongen et al Leucemia 2003

U. Hershberg et E.T. Luning Prak 2015

Van Dongen et al Leucemia 2003 CTGTGCAAGAGCCTCTCTCCACTGGGATCGGGGCCCTTTGACTACTGG FRI FRII FRIII

Van Dongen et al Leucemia 2003

PCR GeneScan analysis region

Example BIOMED-2 multiplex IGH VH-FR2–JH Use of controls

Analysis of TCRB gene rearrangements

Analysis of TCRB gene rearrangements

From the patient to the analysis Selection of material Protocol Check DNA quality Clonality analysis

Examples of cases Case 1: Lymphoma? Reactive? Case 2: Relapse? Case 3: T-cell lymphoma

Case 1 Female 63 years Lymphoma in dec. 2004 FR1 polyclonal, FR3 monoclonal Feb. 2009 biopsy Relapse?

Case 1: GeneScan analysis of controls H2O

Case 1: Relapse? FR3 12/2004 2/2009 Biopsie FR3: 152 bp 2000 600

Case 1: Results Controls ok B-cell targets: IGH(VDJ) FR3 clonal Conclusion of the molecular results: Clonal rearrangement of the IGH gene was detected in this specimen. This gene rearrangement profile is identical to the one detected in the biopsie of 12/2004 and confirms the relapse of the disease.

Case 2 Female 81 years Biopsie Lymphoma?

Case 2 3/2009 biopsie FR1 327,11 bp 2700 control 100

Case 2: Results Controls ok B-cell targets: IGH(VDJ) FR1 monoclonal Conclusion of the molecular results: Clonal rearrangements of the IGH gene were detected in this specimen. This gene rearrangement profile fits to the presense of a monoclonal B-cell population/B-NHL.

Case 3: Male 75 years Lymphoma origine? 2 biopsies First results: FR1, 2, 3 kappa polyclonal

Case 3: TCRG

Case 3: TCRG

Use of clonality analysis 1. Making the diagnosis Normal  reactive  malignant 2. Assessment of remission and relapse 3. Involvement (staging) 4. Evaluation of treatment effectiveness Detection of minimal residual disease (MRD) MRD-based risk-group stratification (treatment reduction or treatment intensification)

4. Take home message Gene rearrangements of the antigen receptor genes occur during the lymphoid proliferation These gene rearrangements generate products that are unique in length and sequence in each cell. In a clonal population (from one cell) all cells have the identical gene rearrangement. Unique length allows by PCR discrimination of monoclonality and polyclonality Standardized protocol