From Gene to Protein

(think about what the functions of proteins are in living things…) What do genes code for? PROTEINS! (think about what the functions of proteins are in living things…) ______ proteins _______________

______________________________________ The “Central Dogma” ______________________________________ transcription translation DNA ______ protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation Do any organisms violate the central dogma? replication

Protein Synthesis: From gene to protein aa a _________ _________ transcription translation DNA mRNA protein ribosome trait

RNA RNA Monomers = nucleotides ____________ Nitrogen Bases uracil instead of thymine ________________ C bonds with G _________________ Location: Nucleus or cytoplasm RNA

Types of RNA Ribosomal RNA (rRNA) ____________________ Major component of ribosomes ____________________ Folded upon itself Carries the amino acids to the mRNA ______________________ Sequence of nucleotides that determines the primary sequence of the polypeptide ______________________________ snRNA (small-nuclear “snurps”) Forms the “spliceosomes” which are used to cut out introns from pre-mRNA ___________________________ targets specific mRNA and prohibits it from being expressed

Transcription: DNA to mRNA Location: ____________ ____________________________________________________________________________________________ Leaves the nucleus through the nuclear pores to find a ribosome!

How is Transcription Started? Transcription Factors Cell signal to transcribe Bind to promoter region _______________ Other TF’s bind ______________________________________ Turns gene on or off

Modifying the Transcript… animation exons = _______________ expressed / coding DNA introns = ______________ in-between sequence _____________________________________ intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Starting to get hard to define a gene! Alternative Splicing _______________________________________ Not all the exons may make it to the final product Intron presence can determine which exons stay or go Increases efficiency and flexibility making proteins Starting to get hard to define a gene!

Final mRNA processing for Eukaryotes ______________________________(enzymes in cytoplasm will attack mRNA!) add ______________ A 3' poly-A tail mRNA 5' 5' cap 3' G P 50-250 A’s eukaryotic RNA is about 10% of eukaryotic gene.

Summing Up Transcription:

Understanding the Genetic Code Code is “almost” universal amongst all organisms (evolutionary heritage) Each CODON of mRNA = 3 nucleotides (EX: CCG, AUG) 64 different combinations possible ____________________________________ Some codons code for the same amino acids (degenerate or redundancy) Sequence of codons determines the sequence of the polypeptide (ex: Protein: AUG-CCG is NOT the same as CCG-AUG!)

CODON CHART You don’t need to memorize the codons (except for AUG) Start codon _________ methionine Stop codons ___________ Strong evidence for a single origin in evolutionary theory.

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA ? ______________________________ protein

TRANSLATION: _____________________________________________________

Need: RIBOSOMES!!! _________________________________ Functions: Facilitates bonding of tRNA anticodon to mRNA codon to MAKE THE PROTEIN! E P A

Transfer RNA Contains “anticodon” ________________________ Some tRNA may bind with more than one codon (Supports redundancy) “_____________” hypothesis: anticodon with U in third position can bind to A or G

Translation: mRNA to Protein Location: cytoplasm Initiation - start codon found (AUG) Elongation – amino acids are joined _____________________________

Protein Synthesis in Prokaryotes Transcription & translation are simultaneous in bacteria __________ ribosomes read mRNA as it is being transcribed

Prokaryote vs. Eukaryote Differences Prokaryotes DNA in cytoplasm circular chromosome _________________ no introns No splicing Eukaryotes DNA in nucleus _______________ DNA wound on histone proteins introns and exons Splicing Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise.