Cloning the OOMT2 Gene in Roses Kim Lovik Megan Hughes

Source Article Scent evolution in Chinese roses Doi: 10.1073/pnas.0711551105

About the Gene Orcinol O-methyltransferase 2 Catalyzes the final methylation reaction of DMT biosynthesis DMT 3,5–dimethoxytoluene A major component of scent of many modern rose varieties

DNA Source OOMT2 gene is common to all rose species Plan is to use rose petals from a common flower shop rose. Although all parts of the rose contain the gene, the production of the chemical compounds is most prevalent in the petals.

Cloning Strategy Amplify gene by PCR with short primers (without BioBrick extensions) Forward primer: ExonA1_F atggaaaggctaaacag *no spontaneous dimer formation Reverse primer: ExonA2_R tgcaatatcccttgagtaaaactgtatc Forward primer: ExonB1_F aaatgagttcggatattgcatgactgg Spontaneous hairpin dimer formation ∆G -0.56 kj/mol*k Reverse primer: ExonB2_R tcaaggataaacctcaat Spontaneous hairpin dimer formation ∆G - 1.16 kj/mol*k *Two sets of primers to remove intron from bp 799-1018

5’ atggaaaggc taaacag atggaaaggc taaacagctt taaacacctt aaccaaaaat ggtcaaatgg agagcattcc aacgagctac ttcatgctca agcccacatc tggaaccaca tcttcagctt cataaactcc atgtccctca aatctgcaat tcaactaggt ataccagata tcatcaacaa acatggcccc atgactcttt ctgagctcac atctgcacta ccaatccatc caaccaaatc ccacagcgtc taccgcctca tgcgaatatt ggtgcactct ggcttctttg ctaagaaaaa gctgagtaaa actgatgagg aaggttatac ccttactgat gcttcccagc tccttctgaa ggatcatccc ttaagcctaa cgcccttctt aaccgccatg ctcgaccctg ttttgaccac accatggaat tacttgagca cttggttcca aaacgaggac cctacgccat ttgacacagc acatgggatg acattttggg attacgggaa ccatcagcca agtattgccc atttgttcaa tgatgccatg gctagcgatg ctcggttggt caccagcgtg atcatcgatg attgcaaagg agtgtttgag ggattagagt cattggtcga tgttggaggt ggtacaggaa ctgtggcaaa ggctattgct gatgcattcc cacatattga atgcactgta cttgatctcc cacatgtggt ggctgacctg caaggaagta agaacttgaa atatactgga ggtgacatgt ttgaggcagt tcctcctgcc ctatgtcaaa atgagttccc tataacgt 5’ gatacagttt tactcaaggt aattaaattt cagatataat tttatcctaa aaaagtttgg atattatgta tatttcttct atatgctatt ctacttgtga ttaaaatgca ttattttagg caactattta aaacacaaag taacagtcac gtctatatct aattcactga ccaatataaa 5’a aatgagttcg actctggacc aagaccaaag cacttctaat gcttatagtt attttatgtc acgagcagtg gatattgcat gactgg gatattgcat gactggaacg atgaagaatg tatcaaaata cttaagcgat ctagagtggc aattacaagc aaggacaaga aaggcaaggt gattatcata gatatgatga tggagaacca gaagggggat gaggaatcaa ttgaaacgca gctgttcttc gacatgctga tgatggccct cgtcagagga caagaaagga atgagaaaga atgggctaag ctcttcactg atgctggttt taactcc aaataggaac t 5’ cagtgactat aagataactc ccattttggg tttaaggtct ctcattgagg tttatccttg a

Cloning Strategy Insert the amplified gene into a pGEM-T vector via pGEM-T and pGEM-T Easy Vector Systems protocol Ligate back together

Check Progress The DNA product inserted in the vector will be amplified using competent E.Coli Amplified product will be tested to check for the OOMT2 gene. Sequencing

Removing Internal Restriction Site One internal restriction site that would be cut by XbaI (see next slide) Site-Directed Mutagenesis used to mutate one base pair using two new overlapping primers One primer will contain a specified base pair change, which will mutate the internal restriction site. This will create two separate DNA fragments cut near that mutated site. The overlapping primers will be used much like removing an intron, which will connect the two DNA fragments back together. Primers:

Check Progress Amplify new DNA product after site-directed mutagenesis, add XbaI restriction enzyme to test results Use agarose gel electrophoresis to check for proper gene length, to ensure the fragments were reconstructed.

Insertion into BioBrick Vector Cut out gene sequence from T-vector with EcoRI and SpeI restriction enzymes Insert into BioBrick-compatible vector with promoter Bba_K206000-induced in the presence of L-arabinose Bba_K094120-induced by IPTG or arabinose Bba_K206001-induced in the presence of L-arabinose

Transformation Transform competent E. coli with our BioBrick vector containing our gene fragment Provide conditions for gene expression Proper growth conditions for E. coli in the presence of arabinose for promoter Spread E.Coli evenly on Prepared Agar Plates Grow overnight at 37°C

Results Test Add 3-methoxy 5-hydoxytoluene (MHT) to the E.coli culture. MHT will be methylated by OOMT2 produced by the E.coli producing DHT Rose scent is produced by this chemical reaction. It is described as “tea scent” and is expected to be a noticeable fragrance when the MHT is added to the culture.