Polymerase Chain Reaction PCR Reaction A powerful molecular technique that exploits DNA replication (or copying of DNA) that normally occurs in all cell. HINT: Be sure to define terms that you aren’t sure they know. Before we get into how PCR works, we will do a quick review of the genetic organization of the cell.

Adenosine, Thymine, Cytosine, Guanine Review of DNA DNA resides in the nucleus of the cell and is organized into chromosomes How many chromosomes do Humans cell have? (wait for students response) Humans have 23 chromosomes Each chromosome comes in pairs, with one coming from the mother and the father. Each chromosome is made of two complimentary strands of DNA, which form a double helix. Each strand is composed of 4 nucleic acids, What the those for nucleic acids (wait for student response) Adenosine, Thymine, Cytosine, Guanine It is the order of the nucleic acids that form genes and we will talk more about the make-up of genes later in the workshop

PCR Reaction PCR Reaction Mix Template DNA PCR Buffer dNTP (A,T,C,G) Forward Primer Reverse Primer Polymerase Enzyme (Taq) So how does we do it? We recreate the environment within a cell in a test tube, including: 1. Template DNA -That we want to amplify 2. PCR Buffer - containing a mixer of salts that creates an environment similar to that inside the cell 3. dNTPs Adenosine, Thymine, Cytosine, Guanine - DNA building blocks 4. Forward and Reverse Primers -Need to tell enzyme where to start to replicate -binds to DNA at regions on either side of the region that we want to replicate 5.Polymerase Enzyme  Taq -Enzyme that replicates DNA -Taq comes from bacteria Thermophilus aquaticus – ASK: Where do you think it likes to live? Wait for it - hot water -Only difference between Taq and the polymerase in your cell is that Taq can be heated to 96oC without being destroyed, where our polymerase is destroyed at temperature around 50oC. What temperature does it like? – 37oC

Polymerase Chain Reaction (PCR) 5’ – ACGTACGTAGCGATGCTAGCTGACACTGACTG – 3’ 3’ – TGCATGCATCGCTACGATCGACTGTGACTGAC – 5’ Template DNA I I I I I I I I I I I I I I I I I I I I I I I I I I I 5’ – ACGTACGTAGCGATGCTAGCTGACACTGACTG – 3’ 3’ – TGCATGCATCGCTACGATCGACTGTGACTGAC – 5’ Denature (96oC) Single PCR cycle 5’ – ACGTACGTAGCGATGCTAGCTGACACTGACTG – 3’ 3’ – TGCATGCATCGCTACGATCGACTGTGACTGAC – 5’ 3’ – TGTG – 5’ 5’ – GTACG – 3’ Primer Annealing I I I I I I I I I PCR Reaction Composed of three steps 1. Denature  the heat disrupts the hydrogen bond between nucleic acids resulting in single strained DNA 2. Primer Annealing  This temperature varies depending on the length and composition of the primer, and ranges from 50 to 70oC. Primers bind to complimentary sequence. A  T and C  G 3. Extension  DNA polymerase starts replicating DNA inserting the complimentary nucleotide So as you can see DNA polymerase does not stop a set spot on the template DNA, so why do we not get a number of different size pieces of DNA To examine this we will go through one more cycle of PCR and it will become obvious! 5’ – ACGTACGTAGCGATGCTAGCTGACACTGACTG – 3’ 3’ – TGCATGCATCGCTACGATCGACTGTG – 5’ 3’ – TGCATGCATCGCTACGATCGACTGTGACTGAC – 5’ 5’ – GTACGTAGCGATGCTAGCTGACACTGACTG – 3’ Extension(72oC) I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I

Polymerase Chain Reaction (PCR) Template DNA 5’ – ACGTACGTAGCGATGCTAGCTGACACTGACTG – 3’ 3’ – TGCATGCATCGCTACGATCGACTGTG – 5’ 3’ – TGCATGCATCGCTACGATCGACTGTGACTGAC – 5’ 5’ – GTACGTAGCGATGCTAGCTGACACTGACTG – 3’ I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 3’ – TGCATGCATCGCTACGATCGACTGTGACTGAC – 5’ 5’ – GTACGTAGCGATGCTAGCTGACACTGACTG – 3’ Denature (96oC) 2nd PCR cycle 5’ – GTACGTAGCGATGCTAGCTGACACTGACTG – 3’ 3’ – TGTG – 5’ Primer Annealing I I I I At the top we have the synthesized DNA from the first PCR cycle can then be used as template DNA for second PCR cycle. Once again the DNA is denatured and the primer bind to the DNA. The yellow stand being the DNA we synthesized in the first cycle, and the red being the primer from the first cycle. During the extension step (Blue) DNA polymerase comes to the end of the piece of DNA and falls of, stopping DNA synthesis. This newly synthesized DNA was binding sites for both primers and will be the template for all PCR cycles to come, with the DNA polymerase always falling of the end stopping DNA synthesis during each cycle. While original template DNA continues to be available as template DNA for the PCR cycles it is this (blue and red) small piece of DNA who’s numbers grow exponentially. 3’– CATGCATCGCTACGATCGACTGTG – 5’ 5’ – GTACGTAGCGATGCTAGCTGACACTGACTG – 3’ Extension(72oC) I I I I I I I I I I I I I I I I I I I I I I I I I

Polymerase Chain Reaction (PCR) 1  2  4  8  16     35 cycles 34,359,738,368 As I mentioned on the previous slide the number of copies of DNA grows exponentially. In a normal PCR we run around 35 cycles. Assuming we ran 35 cycles in theory how copies of DNA of interest do you thing we would have? Note to Presenter: Pause for a moment and let the student try to guess, whether they would expect thousands , millions or billions of copies.