DNA Replication
Learning Objectives Explain what DNA replication is and the purpose
What is DNA Replication? DNA Replication - the process of making two identical copies of DNA from the original parent DNA
Purpose of DNA Replication DNA has to be copied before a cell divides DNA is replicated during the S phase of interphase New daughter cells have an identical set of DNA.
Where Does Replication Occur? Nucleus DNA Replication occurs in the nucleus
How does DNA replication start? Replication starts at the Origin of Replication The parent DNA strand unzips forming a Replication Fork
Replication Bubbles Each DNA strand has multiple sites of replication - replication bubbles Replication proceeds in both directions until each chromosome is completely copied.
DNA Template Each side of the parent DNA strand serves as the template for the new strands
Complementary DNA Strands Two new complementary DNA strands are made following the rules of base pairing G C A T
Stop Here
Steps of DNA Replication
Learning Objectives Describe the steps of DNA replication
Step 1: Uncoil and Unzip - Helicase The enzyme Helicase unwinds and separates the 2 DNA strands by breaking the weak hydrogen bonds.
Primase Creates a Primer Primase tells DNA polymerase where to start replication.
Step 2: DNA Polymerase makes new DNA strand DNA polymerase adds individual nucleotides to produce a complementary DNA strand
Direction of replication DNA replication occurs in a 5’ to 3’ direction
DNA Ligase Ligase joins the sections of DNA together
Semi-Conservative Replication Two identical copies of DNA are made, each containing one original strand and one new strand.
Steps of DNA Replication Uncoil and unzip parent DNA molecule Complementary nucleotide bases forms new hydrogen bonds with parent strand Each new DNA molecule contains one old strand and one new strand (semi-conservative replication)
Practice DNA Replication Original DNA: TCCTGACCCCGCCCGGAT AGGACTGGGGCGGGCCTA Original DNA: CCTATATCTCTCTATATCTC GGATATAGAGAGATATAGAG
Amoeba Sisters DNA Replication YouTube Video Honors Amoeba Sisters DNA Replication
YouTube Video Lab Biology DNA Replication by Interact Medical
Stop Here
Where Does Replication Occur? DNA Replication occurs in the nucleus