Do Now Question If there was a chance you inherited a genetic disease (but did not yet have it) and a genetic test for the disease was available, would you want to be tested for the disease or not? Explain your choice in 3-5 sentences.

Genetic Diseases Ms. Bush Genetics Unit

Autosomal Genetic Diseases

Cystic Fibrosis An autosomal recessive disease (chromosome 7) Results in abnormal mucus build-up in the lungs More common in people of European decent

Cystic Fibrosis

Sickle Cell Disease Autosomal recessive disease (chromosome 11) Causes red blood cells to be sickle shaped Most common in people of African decent

Sickle Cell Disease

Tay Sachs Autosomal recessive disease (on chromosome 15) Nervous system disease Causes deafness, blindness, muscle tone loss, delayed mental and social skills 1 in 27 of Ashkenazi Jewish people have disease Also common in people of Cajun and French Canadian ancestry

Phenylketonuria (PKU) Autosomal recessive (chromosome 12) People with PKU cannot break down phenylalanine Causes delayed mental and social skills if not detected early All newborns in US screened for PKU Phenylalanine (amino acid)

Huntington’s Disease Autosomal dominant (chromosome 4) Nerve cells degenerate Late onset (30s-40s) Caused by CAG repeats in DNA 50% of children will inherit this disease if one parent has it CAGCAGCAGCAGCAGCAGCAGCAG

Sex-linked Genetic Diseases XY XX

Hemophilia A genetic disease that is carried on the X chromosome This disease prevents blood from clotting In severe cases, it can cause death by excessive bleeding

Famous Example of Hemophilia

Duchenne Muscular Distrophy Causes continual degeneration of muscles Recessive X-linked disease Diagnosed between ages 2-6 Few survive beyond age 30

Pedigrees