MIGRAINE: Is it just bad timing?

Slides:

Advertisements

Similar presentations

Understanding Insomnia Insomnia: – trouble falling asleep, – staying asleep, waking too early, – Don’t feel refreshed when you wake up. – Sleepy and tired.

Advertisements

2 Phases: REM and Non-REM Sleep Non-REM Sleep  4 stages of progressively deeper sleep  Normal muscle tone  Associated with increased 5HT (serotonin)

Sleep When a cup of warm milk is not enough K. Van Gundy, M.D. Associate Clinical Professor UCSF.

Sleep Disorders Answers based on DSM-IV-TR and Tasman and First unless otherwise stated. As of 1Aug07.

By Dr. Nathaniel J. Kingsbury Friday, October 24, 2014, 10:00 a.m. Southwick Hall, Room 401.

Sorting out your Headache patients Dr John G Hughes BASH for FDA

Comparison of Wildtype vs. FASPS Mammalian Molecular Clocks By Erin Eppler May 2010

Research Institute for Sport & Exercise Sciences FACULTY OF SCIENCE Circadian rhythms and swimming performance Greg Atkinson Chronobiology Research Group.

Jet Lag – A Consequence of Disrupted Sleep Rhythms.

MCB 186 CIRCADIAN BIOLOGY Week 2 Entrainment by light and the Phase Response Curve (PRC) September 26, 2007 J. W. Hastings.

Dose- and Circadian- Dependent Melatonin Entrainment in Humans By Naila Ramji.

Rhythms. Types of Rhythms Circadian: about 24 hours Ultradian: less than 24 hours.

BIO CLOCK B. E. S. T (97`) AN BUM JU DEFINITION  일정한 주위상황 (Constant Condition) 에서 반복적으로 일어나는 행동이나 생리학적 변화의 주기.

Department of Neurology, SJUH Acute headache Problems that can not wait until the post take ward round

The Neurobiology of Sleep and Sleep Disorders Tamara Blutstein, Ph.D. Department of Neuroscience Tufts University School of Medicine May 1, 2013.

Oral triptans (serotonin 5-HT 1B/1D agonists) in acute migraine treatment: A meta-analysis of 53 trials by Michel D. Ferrari, Krista I. Roon, Richard B.

Edit the text with your own short phrases. To change the sample image, select the picture and delete it. Now click the Pictures icon in the placeholder.

My migraine ruins my weekends CLINICAL CASE Presented by: Julio Pascual Neuroscience Area, Service of Neurology, University Hospital Central de Asturias.

Relationship of Stress to Migraine Headaches. Type of headache Intense throbbing pain of the head, temples or behind one eye or ear Can also cause nausea.

Menstrual Migraine (MM) Definitions: true MM—attacks occur only perimenstrually; menstrually related migraine— attacks predictably associated with perimenstrual.

Quantitative modelling of sleep-wake cycles and application to shiftwork Svetlana Postnova Alertness CRC Ltd & School of Physics, The University of Sydney,

Acute treatment of migraine Dr Mark Weatherall London Headache Centre 2010.

Migraine Headaches By Robby Hammonds. Causes of Migraines Some of the main causes of these headaches are food, stress, bright lights, sounds, changes.

MANAGEMENT OF CHRONIC HEADACHES IN PEDIATRIC POST-CONCUSSION SYNDROME Susan Beaird, DNP, CPNP Lauren King, MSN, CPNP.

Disrupting Biological Rhythms. Write down all you know about the disruption of biological rhythms.

Individual differences To know how individual differences influence Circadian research To understand the role of genes in circadian phase disorders To.

BALANCING LIFE’S ISSUES, INC. Learning About Headaches.

Copyright © 2010 Pearson Education, Inc. publishing as Benjamin Cummings Lectures by Greg Podgorski, Utah State University Why Migraines Strike Current.

Preferred Temperature, Metabolic Rate, and Circadian Rhythms of Snapping Turtles (Chelydra serpentina) Amy Pikovsky

Chapter 12: Wakefulness and Sleep. Endogenous Cycles 1. Many animals have a circannual rhythm 2. Most animals, including humans have a circadian rhythm.

Disrupting Biological Rhythms AO1. Write down all you know about the disruption of biological rhythms.

Precious Battle March 6 th 2013 Block 1. Scientific/Common name Is Migraine Headache.

Sleep Problems in Traumatic Brain Injury Eilis Boudreau M.D., Ph.D.

Taattcgcggccgcttctagagattgtgagcggataacaattgacattgtgagcggataacaagatactgagcactactagagaaagaggagaaatactagatgactataatgataaaaaaat cggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactc.

Evolution of Sleep Wake Cycles

Vern Putz Anderson Wholesale Retail Trade Sector Sector Coordinator Vern Putz Anderson Wholesale Retail Trade Sector Sector Coordinator MSD Research Issues.

ALTERED STATES OF AWARENESS

By RAJA SITI MARDHIAH RAJA AZMI & AFIF NUHAA JUWAHIR.

I Just Want To Sleep! Understanding Circadian Rhythm By: Sumayia Hussain Sabantu Yusuf Selam Kidane.

Responses of organisms to abiotic factors (This is an overview. Later we will go into more details with examples of plants and animals)

The Basics of Good Pain Control: Understanding and Assessment Dr. Leah Steinberg.

How Chronic Fatigue Syndrome Affects Your Body Dr. Peter Dobie.

1997 NIH Consensus Myofascial pain Osteoarthritis Low back pain Headache Menstrual cramps Tennis elbow Fibromyalgia Carpal tunnel syndrome Addiction Stroke.

Shift Work and Shift Work Sleep Disorder

Neuronal Control of Behavior

Case presented by Dr Polkinghorn

The Bridge Recovery Center Physical pain, emotional pain, loss of motivation, or lost direction... We can help!

النوم - ماذا تعرف عنه؟ دراسة مبسطة عن النوم و مراحله و كيفية الحصول على نوم صحي

النوم - ماذا تعرف عنه؟ دراسة مبسطة عن النوم و مراحله و كيفية الحصول على نوم صحي

Circadian Rhythms: To Sync or Not To Sync

The Genesis of Pain in Migraine

Insomnia pharmacotherapy: Ramelteon

Circadian Rhythms: To Sync or Not To Sync

Behavioural rhythms and light‐induced phase and period responses in Jnk3‐deficient mice. Behavioural rhythms and light‐induced phase and period responses.

Biorhythms Recap circadian rhythms. (outline and evaluate)

CANOA Trial design: Patients undergoing percutaneous closure of an ASD with the Amplatzer Septal Occluder were randomized to aspirin 80 mg plus clopidogrel.

Nat. Rev. Cardiol. doi: /nrcardio

Efficacy of transdermal nitroglycerin combined with etodolac for the treatment of chronic post-thoracotomy pain: An open-label prospective clinical trial

Time in Motion: The Molecular Clock Meets the Microbiome

Volume 24, Issue 7, Pages (March 2014)

Fig. 1 Double-raster plot demonstrating the timing of sleep in the chronic sleep loss and control protocols Double-raster plot demonstrating the timing.

A 53-Year-Old Woman With Recurrent Vomiting and Migraine Headache

Volume 25, Issue 14, Pages (July 2015)

Yoshiaki Yamaguchi, Hitoshi Okamura

Blakemore (1988) studied workers at a chemical plant in Utah who worked a three weekly schedule: the first week a night shift, the next week an evening.

Chronic jet-lag increases mortality in aged mice

Typical manifestation of migrainous infarct on MRI diffusion weighted imaging in a 45-year-old female patient with chronic migraine with aura. Typical.

Typical manifestation of migrainous infarct on MRI diffusion weighted imaging in a 45-year-old female patient with chronic migraine with aura. Typical.

Circadian Dysfunction and Obesity: Is Leptin the Missing Link?

Fig. 3 The human FABP7 point mutation phenotype is recapitulated in Fabp7 KO mice, which also showed sleep fragmentation. The human FABP7 point mutation.

Presentation transcript:

Headache Group @ King’s

MIGRAINE: Is it just bad timing? Circadian Mechanisms in Migraine Lauren Strother, PhD Candidate Migraine Trust International Symposium 9 September, 2018

Migraine and Circadian Rhythms Migraine Susceptibility Shift Work Jet Lag Migraine Attack

Migraine and Circadian Rhythms Migraine Attack Onset Chronotypes Shift Work Alstadhaug et al. (2008) Headache. 48(1): 95-100 van Oosterhout et al. (2018) Cephelagia. 38(4): 617-625

Migraine and Circadian Rhythms FAMILIAL ADVANCE SLEEP PHASE SYNDROME (FASPS) Shift Work

FASPS Mice: Migraine Readouts Migraine Aura N=12/12; P<0.001 * n = 12/12; p < 0.05 Strother et al. (2017) Cephalagia. 37(IS) p202 Control

FASPS Mice: Migraine Readouts Migraine Allodynia * n=12 p < 0.01 Baseline 2hr NTG Control FASPS Control FASPS Migraine Trigger: Nitroglycerin (NTG) Strother et al. Unpublished

Circadian Variation in Pain Perception Diurnal Variation in WT n=24 Strother et al. Unpublished

Chronic Jet Lag Diurnal Variation in WT * * Lights On: 7:00h Lights Off: 19:00h * * n=12 n=12 Controls Jet Lag Controls Jet Lag Strother et al. Unpublished Strother et al. Unpublished

Migraine Susceptibility Hope for the Future Migraine Susceptibility Shift Work Jet Lag

Dr Philip Holland Professor Peter Goadsby Dr Marta Vila Pueyo Jao Saengjaroentham Paula Sureda Gibert Dr Olivier Brock