Animal Development Drosophila axis formation Part 1: A-P patterning Part I introduces Drosophila development, the life cycle, terminology and tissues. Oogenesis and early embryogenesis. The role of maternal and zygotic gene expression is discussed. There is a overview of the hierarchy of genes controlling anterior-posterior patterning and segmentation. This introduces the practical that follows in TT. The core part of this lecture is concerned with dorsal-ventral patterning, the different signals that establish asymmetry in the embryo and some of the mechanistic principles underlying these pathways. A recurring theme is how different signalling pathways may be recruited to different developmental processes both in Drosophila and in vertebrates. Synopsis: Review of Drosophila life cycle, terminology and tissues. Maternal and zygotic gene expression. Origin of the asymmetry and localised determinants in the egg. Subdivision and specification of the embryonic pattern. Transcriptional and translational regulation in embryogenesis. Where to study signal transduction pathways. petros.ligoxygakis@bioch.ox.ac.uk

In this lecture: The origin of Anterior-Posterior Axis Mutant screens to isolate segmentation genes Genetic analysis of early acting determinants Important roles of post-transcriptional regulation and mRNA/protein localisation Methods of dissecting enhancers Dosage-dependent activation of zygotic genes Hierarchical organisation of segmentation genes

THEY LIVE….

1 * egg: generate the system * larva: eat and grow Developmental biology: Drosophila segmentation and repeated units * egg: generate the system * larva: eat and grow * pupa: structures in larvae grow out to form adult fly: metamorphosis (Drosophila is a holometabolous insect) 1

The early embryo is a syncitium The unusual feature of the Drosophila early embryo is that the first 13 mitoses are nuclear divisions without concomitant cytoplasmic division, making the embryo a syncitium-a multinucleated cell. After division 9, the plasma membrane of the oocyte evaginates at the posterior pole to surround each nucleus thus creating the pole cells, which will form the fly’s germ line.

Segments in embryos are maintained throughout development

Forming complex pattern: establishing positional information

The Hunt for Mutants 30,000 independently-derived mutants in genes required for survival. 8,000 mutants define genes required for embryonic survival (these became the focus the study). 750 mutants have specific effects on A/P or D/V patterning. 150 genes with specific effects on A/P or D/V patterning identified by the 750 mutants (average of ~ 5 alleles per gene).

A Detour Into Embryonic Anatomy – Denticle Bands Denticle bands on a 1st instar larva. Denticle bands are hair-like projections on the ventral cuticle of an embryo. Denticle bands provide an easily visualized marker of embryonic/larval pattern.

Maternal effect genes Phenotype of the embryo is determined by the genotype of the mother. The polarity and spatial coordinates of the embryo are initially set by the products of these genes (therefore, sometimes called “coordinate genes”). The gene products, either mRNA transcripts, proteins, or cell surface ligands are contributed by the nurse cells or follicle cells as the egg is constructed. The dorsal-ventral axis (1 gene-system, 12 genes) and anterior-posterior axis (3 gene-systems; anterior, 4 genes, posterior, 11 genes, and terminal, 6 genes) determined by maternal effect genes. Originally isolated as homozygous mutant, adult females that lay normal looking eggs that do not develop at all, regardless of the genetic contribution of the male.

Four Independent Genetic Regulatory Systems Specify the Anteroposterior and Dorsoventral Axes

Maternal effect genes All four systems share several properties: (i) the product of (at least) one gene is localized in a specific region of the egg, (ii) this spatial information results (directly or indirectly) in an asymmetrical distribution of a transcription factor, (iii) the transcription factor is distributed in a concentration gradient that defines the limits of expression of one or more zygotic target genes, such as segmentation genes.

Establishment of AP axis in oogenesis and bicoid localisation by Gurken signalling. In early stage egg chambers MTOC is in the oocyte, and gurken mRNA is localised at posterior. Translation and limited diffusion means signal sent to overlying posterior follicle cells (received via torpedo receptor). A signal is sent back which activates protein kinase A in the egg oocyte cytoskeleton is re-organised and directs the localisation of bicoid and oskar, defining the A-P axis.

Bicoid mutant embryos lack head and thorax structures bicoid/bicoid mother +/+ mother

Effect of replacement of the 3’ UTR of the nos mRNA with the 3’ UTR of bcd mRNA The nos-bcd transgene is able to localise at the anterior pole and as a consequence NOS protein will inhibit translation of the hb and bcd mRNAs.

The Bcd gradient mRNA (in situ) Protein (Ab staining)

Concentration gradients of BCD and HB-M establish A-P axis Positional information along the A-P axis of the syncitial embryo is initially established through the creation of concentration gradients of two transcription factors: Bicoid (BCD) and Hunchback (HB-M). These are products of two maternal effect genes their mRNAs provided by the mother and stored in the embryo until translation initiates. These factors interact to generate different patterns of gene expression along the axis.

Bicoid is an Anterior Morphogen Note that bicoid (and other maternal effect gene products) diffuse in the shared cytoplasm of the syncytial blastoderm. This is a unique feature of insect embryogenesis.

BCD acts as a concentration-dependent manner

Thresholds can turn gradients into sharp boundaries Bicoid protein required for early activation of zygotic hunchback. Bicoid contains homeobox Mutations in homeobox results in failure of Bicoid protein to interact with hunchback target sequences.

bicoid protein gradient gradient is interpreted at least at four different levels (thresholds).

bicoid as a repressor of posterior fates Bicoid binds the 3’ UTR of caudal mRNA and suppresses translation. Caudal protein enters the nuclei at the posterior end of the syncytial blastoderm and helps specify posterior fates Caudal protein

At the Posterior: nanos localisation by Gurken signalling oocyte cytoskeleton is re-organised and directs the localisation of bicoid and oskar, defining the A-P axis. oskar mRNA binds Kinesin I and Staufen proteins. Kinesin I localises oskar mRNA to posterior Staufen allows translation of oskar mRNA Oskar protein binds nanos

Effect of posterior group genes on hunchback. primary gene is nanos. nanos mRNA is tightly localised to the posterior pole of the egg.

Effect of posterior group genes on hunchback. The role of nanos is to disable hb maternal mRNA at the posterior end of the egg.

Four Independent Genetic Regulatory Systems Specify the Anteroposterior and Dorsoventral Axes

Terminal group genes

Torso: TRK signalling via MAPK

Segmentation pattern Obvious segmentation begins to develop by germ band extension stage. The embryonic segmentation pattern has direct analogs to the final segments of the adult. Segmentation pattern can be thought of as classical segments or midsegment-to-midsegment intervals called parasegments. Some early embryonic segments become incorporated into the complex structures of the head and mouth.

The mutant phenotype tells us where the gene is normally required

Segmentation genes The segmentation genes form a cascade of transcription factor gene expression. The genes use positive and negative regulation to generate the pattern of striped expression. The pattern is established very early in development (i.e. even before the cells “look different”), and determines the fate of specific cells. Many of the genetically defined interactions have also been shown to have direct molecular interaction. While the gap and pair-rule genes do not seem to act after gastrulation, their appearance has permanently stamped positional values on the cells.

hunchback gene hunchback As well as maternal it is also a Gap gene (zygotic) contains zinc finger domain homologous to TFIIIA (transcription factor in Xenopus) hunchback deletion in zygote - gnathal and thoracic segments deleted.

5 binding sites for bicoid in the hunchback promoter genomic 1 2 1 2 3 B A 2.9kb zygotic transcript 5’ 5’ 3.2kb maternal transcript B1 TTTTACTTTATTAATTCATGCTAATCTGATGACTG... B2 ATTCTATCTCATAATCACCTTTAATCCCAAGTACT... A1 TGCTGTCGACTCCTGACCAACGTAATCCCCATAGAA... A2 CATAATTTTTTGTTTCTGCTCTAATCCAGAATGGA... A3 CTTCCCGTCACCTCTGCCCATCTAATCCCTTGACGC Consensus = TCTAATCCC

123bp of hunchback promoter needed for correct spatial expression of hunchback.

Patterns of Gap Gene Expression Hunchback expression is controlled by bicoid. Hunchback is the master gap gene. Hunchback and bicoid together control other gap genes.

The Hunchback Gradient Controls the Expression of Other Gap Genes

Maternal Coordinate Genes A Gene’s Sphere of Influence Extends Only To Where Its Product is Expressed Maternal Coordinate Genes bicoid (bcd) caudal (cad) hunchback (hb) nanos (nos) hunchback (hb) Krüppel (Kr) knirps (kni) giant (gt) tailless (tll) Gap Genes Pair-Rule Genes even-skipped (eve) odd-skipped (odd) hairy (h) runt (run) fushi-tarazu (ftz) paired (prd) Segment Polarity Genes En engrailed (en) wingless (wg)

Pair-Rule Genes Are Expressed in Alternating Segment-Width Bands Eve (gray) and ftz (brown) expression patterns.

Enhancer trapping in Drosophila Use transposon P element Carries reporter gene e.g. b-galactosidase Hops into genome When lands near enhancer, activates gene expression Expression similar to that of neighboring gene P element recognition sites TATA b-galactosidase P element vector enhancer gene Y enhancer b-galactosidase gene Y

Regulation of eve stripes 3 and 7 eve 1 to 7 eve 1 and 7 hb-Z kni

Transcription Factors and Their Binding Sites in the eve Stripe 2 Module Determine binding sites by footprinting Note that these transcription factors are the products of patterning genes higher in the regulatory hierarchy to eve. Determine importance of enhancer elements by mutagenesis.

Regulatory Protein Gradients That Control the Eve Stripe 2 Module The sharp Hunchback (green) and Kruppel (red) expression boundary.

Interaction Between Gene Products Sharpens Expression Boundaries early late Sharpening eve-ftz stripes. Autoactivation and mutual inhibition of the eve and ftz transcription factors Ftz Eve

Regulatory Gene Cascades and Interactions- Segment Polarity Genes

Mutations of Segment Polarity Genes Often Cause Mirror Image Duplications of a Portion of Each Segment

Segment Polarity Genes Are Expressed in a Portion of Each Segment Once activated, segment polarity gene expression persists in the embryo and adult. Expression of engrailed in the embryo and adult.

Summary Initial asymmetry for AP axis set up during oogenesis Pattern organised by maternal proteins soon after fertilization Localised maternal proteins activate or repress zygotic genes Transcriptional and post-transcriptional regulation Gradients of transcription factors are refined by mutual activation and repression and cell-cell signalling.

Footnote: Transgenes in P-elements are used to transform flies Gene of interest is inserted into P-element vector with w+ marker Transformation plasmid is mixed with helper plasmid encoding transposase The mixed DNA is injected into the posteriors of w- embryos (where germline cells develop) The mobilized P-element will insert ~ randomly into the genome Transformed adults carrying the w+ marker will have red eyes