Hui Wang OARDC E-mail:wang.t3@osu.edu How to use SSRHunter Hui Wang OARDC E-mail:wang.t3@osu.edu.

Slides:

Advertisements

Similar presentations

EA Testing Instructions By Ross Todd. Open C Drive.

Advertisements

Clicking on the link for the.tns file gives you will get the following screen: Select Save File and click OK.

For suggestions about how Talk Factory can be incorporated into lessons on investigating evaporation please see the associated lesson plans on the Talk.

MT Software Emulator Setup. 1. On the P Drive Here is the software 2. Create this folder in My Documents 3. Copy this.IMG File Into the folder 4. Execute.

Downloading Audacity software Julie Collareda Adapted from Shaughnessy 2006.

STEPS TO DOWNLOAD THE SOFTWARE EXE’S FROM WEBSITE.

Corporate Property Automated Information System (CPAIS) Macro Walkthrough Guide for Excel Version 2003.

Web Application Server Apache Tomcat Downloading and Deployment Guide.

Talk Factory Primary Generic: instructions for use Supporting children‘s whole class discussions in primary school Copyright 2011 Open University.

Podcasting in Libraries: Downloading Audacity software Kathryn Shaughnessy Instructional Services Librarian Prepared for METRO SIGs, January 13, 2006.

Installation on Windows Vista/Windows 7 NOTE: Installation on Windows Vista can differ depending on the version of Windows installed In most computers.

Creating & Attaching CSS An CSS Primer Tutorial. A New CSS Document Create a new CSS Document in Dreamweaver using the “New” option under the File Menu.

Podcasting at St. John’s: Downloading Audacity software Kathryn Shaughnessy Instructional Services Librarian.

Created in 2011 at Liberty High School. Getting Started Overview on Magnet Tool – Graphics – Text – Image – Video – Sound – Wall A Sample Glog How to.

How to Export Question Bank. Step 1: Select Export Question Bank Over here!!!

Designing CAPS markers using SGN CAPS Designer

New Class Name Here EFRT 308 EFRT 460 EFRT 461 WordPress.

CSS Sprites. What are sprites? In the early days of video games, memory for graphics was very low. So to make things load quickly and make graphics look.

© Copyright 2000, Julia Hartman 1 Next An Interactive Tutorial for SPSS 10.0 for Windows © by Julia Hartman Using Command Syntax.

Embedding Video in Powerpoint. Embedding Video The most important thing to know about using video in PowerPoint (and the most common mistake) is that.

Playing Music in Alice By David Yan Under the direction of Professor Susan Rodger July 2015.

Microsoft Publisher Tutorial Ms. Carino’s Class Grade 3 March 8,

Module 1 Section 1.3 DNA Technology

Creating webpages in Google Sites. 1- Create a Gmail account.

Copyright OpenHelix. No use or reproduction without express written consent1.

TURNER COUNTY SCHOOL SYSTEM Uploading Lesson Plans with eBackpack.

Manipulation of DNA. Restriction enzymes are used to cut DNA into smaller fragments. Different restriction enzymes recognize and cut different DNA sequences.

Downloading and Installing Autodesk Revit 2016

How to access the project from googlecode using GIT.

By Jesus Juarez. Download the software from or your preferred website.

Playing Music in Alice By David Yan Under the direction of Professor Susan Rodger July 2015.

POWER TEACHER GRADE BOOK TRAINING Tracy Tom Tina.

PowerPoint Basics Tutorial 4: Interactivity & Media PowerPoint can communicate with the outside world by linking to different applications, managing different.

Right-click on this, and select: Copy To Folder …

How to Install Eclipse Click hereClick here to download Eclipse.

Copy of the from the secure website - click on the AccoridaLife.zip link.

Know your computer Make a Folder Copy from Word to Composer Format the Font Change the Alignment Format the Background Format the Colors Insert a Picture.

Uploading Multiple Files to the Agricultural Education and Training Archive.

CuffDiff ran successfully. Output files include gene_exp.diff What are the next steps? Use Navigation bar to find files; they may be under DNA Subway if.

Note:- You can unpin it any time you wish to…..

Tips on inserting images in slideshows downloading images from the internet (NOT copy and paste) making the background transparent minimising the image.

Diagramming Assistance. If you are having difficulty… First, refer to your class notes. Every part of speech we have diagrammed thus far has been demonstrated.

How do I download or save a YouTube video to my computer? Khairunnazmi Bin Khairudin (B01SKS13F010) Ahmad Zaidi Bin Abdul Manan (B01SKS13F017)

Download framaroot app BY : framarootapk.netframarootapk.net.

 When preparing a lesson, create a new folder  Put ALL materials related to the lesson into the folder  Include all video clips, audio clips, documents,

Find a Driver For HP 7150 Series Printer in Windows 7, 8 and XP.

An Interactive Tutorial for SPSS 10.0 for Windows©

Downloading & Installing the BIT115 Software & Programs

Fall HORT6033 Molecular Plant Breeding

Task 2f – part a Prove that you can receive an WITH an attachment, open it AND save the attachment to your user area. Open the with the attachment.

Using the HTML and CSS Validation Services

Using a set-up file to read ASCII data into SPSS

Your First & Last Name (Make sure you capitalize your first and last name!) Follow these instructions: 1. Center your name on the slide (use the “Centered”

Producing Conservation Business Plans from Miradi

How to Install an old version of Adobe Reader on Mac OS.

Genetics and Biometrics

Install Ruby If you are running on Mac OS X, Ruby is preinstalled.

How to Install Borland C++

How to Install Borland C++

Downloading Photos from a digital camera.

HOW TO INSTALL AOL DESKTOP GOLD The popularity of AOL Desktop Gold in the world of desktop software is increasing and along with it, the demand increases.

How to Install Borland C++

3.1 Basic Concept of Directory and Sub-directory

More to Learn Creating a shortcut

Instructions for Data Base

Thomas J Cradick, Peng Qiu, Ciaran M Lee, Eli J Fine, Gang Bao

Forensic DNA Sadeq Kaabi

Ready to use ESL activities for busy English Teachers

Let's create your English Folder!.

Presentation transcript:

Hui Wang OARDC E-mail:wang.t3@osu.edu How to use SSRHunter Hui Wang OARDC E-mail:wang.t3@osu.edu

Purpose of this tutorial To demonstrate how to download and install SSRHunter software. Demonstrate use of SSRHunter to identify potential SSRs in a sequence. To demonstrate how to design a PCR-based molecular marker for a Simple Sequence Repeat (SSR) using SSRhunter. Hayden, M.J. and P.J. Sharp. 2001. Nucleic Acids Research 29 (8):e44. Li, Q., and Wan, J. M.. Yi chuan. 2005. SSRHunter: development of a local searching software for SSR sites. Ssr or microsatellites are highly polymorphic and abundant sequences dispersed throughout eukaryotic genomes. Targeted development of informative microsatellite markers.

SSR hunter Software language: Chinese and English Operating Systems: Win9x/Me/NT/2000/XP/2003 1: even chinese but it is so handy to use, no problem for person without chinese background; 2:it does not work on mac. 3:Next several slides will show us how to get this software.

Search for “ssrhunter” Click this link!!! That is what I want!!!

Download Page ------------Scroll Down!!!

Click here!!!

Wait 5 seconds!!!

Save or open the program!!! I recommend you SAVE to the DESKTOP and then unpack.

Save to Desktop

Download Complete!!! Click open folder, and Click on the .exe file

1:Choose options 2:Paste in sequence 3:Click Run

This option means the maximum nucleotide repeat unit. eg:attg Simply paste the sequences in this box. The bigger size, the longer processing time. I have used sequences up to ~200Mb. This option means the minimum repeat. eg:attgattgattgattgattg or (attg)5 Click to RUN!!!

Output file!!! No.; repeat; # repeats; position 1:scaffold06004:2320000-2460000 sequence for example Output file!!!

Copy output into a Word or text file.

24. ACA 重复次数： 6 scaffold06004:: 2419808-2420125 99808aatagaggcacataagttacaattaaatagatatcagtacgttctcaataatcgggaaaacaaaatagaagagaaaaaggcaggtgatgaactaagttttcctataaaatagtttatgcttaattttacagctaaaggttgtggaagttgACAACAACAACAACAACAtacctactgtagttccacaagtggggtctgggaatgttaggatgtacacaaaccttaaccctacctttgttgtggaagttgccaaaaaaacaaaaactctatggttgcttggttcagagatatttgaggaccttttctgcaatatcctca 100125 Output contains information for many possible SSR sequences. One example is shown here.

What is the next step? .Primer3 to design your primer according to the SSR hunter output. http://frodo.wi.mit.edu/primer3/ (Uniform Resource Locator for Primer3)

Select product size (I suggest 150-250) Simply paste the sequences in this box. Select product size (I suggest 150-250) Click to pick primers!!!

There are the primers!!!

What is the last step? . Run PCR and separate fragments for validation. . In my experience, more than 60% of putative SSRs identified with SSRHunter detect polymorphisms.

In this example, 3%agarose 3h detects a polymorphism. EP1546/EP1565-PI EP1546/EP1565-OH EP1546/EP1565-H EP1566/EP1567-PI EP1566/EP1567-OH EP1566/EP1567-H EP1568/EP1569-PI EP1568/EP1569-OH EP1568/EP1569-H EP1548/EP1549-PI EP1548/EP1549-OH EP1548/EP1549-H That is what I want!!!

Thank you!!!