Chapter 17 – From Gene to Protein

One Gene – One Enzyme Beadle and Tatum (1930s) Bombarded Neurospora (bread mold) with radiation to create mutants that could grow on different types of nutritional medium Created 3 classes of mutants which grew with different media Deduced each mutant was unable to carry out one step of the arginine pathway Revised theory to One Gene – One Polypeptide (many enzymes are made up of multiple polypeptide chains.

Protein Synthesis: Overview Transcription: Synthesis of RNA under the direction of DNA (mRNA) Occurs in the nucleus (of eukaryotes) Translation: Actual synthesis of a polypeptide under the direction of mRNA Occurs in ribosomes In eukaryotes – mRNA must be processed before translation can proceed

Protein Synthesis Challenge Determine the amino acid sequence for the following DNA template: TACCCTGCGTTAAGCTACCCAATT

The Triplet Code The genetic instructions for a polypeptide chain are ‘written’ in the DNA as a series of 3-nucleotides called a codon ‘U’ (uracil) replaces ‘T’ in RNA

Genetic Code Each codon encodes for one amino acid AUG = start codon or methionine 3 stop codons = UAA, UAG, UGA

Transcription Unit and Terms RNA polymerase: pries DNA apart and hooks RNA nucleotides together from the DNA code Promoter region on DNA: where RNA polymerase attaches and where initiation of RNA begins Terminator region: sequence that signals the end of transcription Transcription unit: stretch of DNA transcribed into an RNA molecule

Transcription: Overview Initiation – after RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis on the template strand Elongation – the polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5’ to 3’ Termination – RNA transcript is released, polymerase detaches, DNA completely reseals

Transcription: Initiation Eukaryotic promoter region contains a TATA box, about 25 nucleotides upstream of start point Transcription factors bind to TATA box, must occur before RNA polymerase II can attach RNA polymerase II and additional transcription factors attach forming the initiation complex Unwinds the DNA and RNA synthesis begins

Transcription: Elongation and Termination Untwists DNA double helix, exposing 10 to 20 nucleotides Adds nucleotides to growing 3’ end Termination: Transcription terminates when polymerase falls off (not exactly understood how in eukaryotes)

Transcription: Review Transcription animation

Eukaryotic pre-mRNA structure 5’ cap – modified guanine nucleotides, thought to function in protecting the reading sequence of DNA, facilitate movement of the mRNA out of the nucleus and aids in ribosome attachment 3’ poly-A tail – 50-200 adenine molecules, similar functions as 5’ cap, protection, recognition, transport mRNA processing animation

Eukaryotic mRNA Modification Exons – coding Introns – non-coding Must remove the introns from the pre-mRNA to create the mRNA transcript snRNPs and proteins form spliceosome Attaches at specific locations on pre-mRNA RNA transcript is cut, introns removed, exons spliced together animation

Evolutionary Significance So what is the biological function of an intron? Some introns control gene activity in some way Some introns may be exons, alternative RNA splicing Multiple domains in one gene Could lead to evolution of new exons (exon shuffling)

Translation: basic concept mRNA is moved through a ribosome Codons are translated into an amino acid sequence, one by one tRNA molecules bring the amino acids to the ribosomes Creation of a polypeptide chain

tRNA Structure Carry amino acids to the ribosomes for translation Anticodon 3’ AA attachment site

tRNA Production Aminoacyl-tRNA synthetase binds an amino acid to its specific tRNA molecule When attached called an aminoacyl-tRNA 20 different synthetases, one for each amino acid 45 different tRNA molecules, but 61 different RNA codons, how is this possible? 3rd base in anticodon can bond to multiple codons For example, U can pair with both A and G in 3rd position of tRNA, also some tRNA have inosine (a purine) in the 3rd position which can pair with A, U, or C

Ribosome Structure Composed of rRNA and protein Each ribosome has 2 subunits, small and large Small subunit has mRNA binding site Large subunit has 3 tRNA binding sites: P (peptidyl-tRNA site), A (aminoacyl-tRNA site), and E (exit site).

Translation: Initiation mRNA binds to small ribosomal subunit Initiator tRNA attaches to the start codon AUG Large subunit attaches with initiator tRNA in p site, uses energy in GTP

Translation: Elongation

Translation: Elongation The anticodon of an incoming aminoacyl-tRNA base-pairs with the complementary mRNA codon in the A-site Large subunit catalyzes the formation of a peptide bond between the amino acids attached to the tRNA in both the P and A sites The growing polypeptide chain is transferred to the tRNA in the A site The ribosome translocates, moving the “naked” tRNA to the E site for removal, exposing the A site for the next tRNA

Translation: Termination When ribosome reaches stop codon, ribosome accepts a release factor protein Hydrolyzes the bond between the tRNA in the P site and the last amino acid in the chain The 2 subunits and other components dissociate

Translation: Review Translation animation

Polyribosomes (or polysomes) Takes approximately a minute to make an average size polypeptide chain Can have multiple ribosomes on the same mRNA chain Enable cell to make many copies of a protein very quickly

Gene Expression Overview

Polypeptides and the ER Proteins destined for export need to be moved through the endomembrane system Growing polypeptide chain (in cytosol) will have a signal peptide sequence Signal recognition particle (SRP) guides ribosome to ER

Point Mutations Mutations are changes in the genetic material of a cell Point mutations are changes in just one base pair Can cause genetic disorders, ex. Sickle cell

Types of Point Mutations Base-pair substitution – the replacement of one nucleotide for another Silent – no effect Missense – still codes for an amino acid, but the wrong one Nonsense – stop codon, premature termination

Other Types of Mutations Insertions and deletions – additions and losses of nucleotide pairs in a gene, usually more of a problem than substitutions Frameshift mutations – when the number of nucleotides inserted or deleted is not a multiple of 3, shifts the codon reading frame, can either be missense or nonsense Mutagen – chemical or physical agent that causes a mutation