Genomics Genetic Analysis on a Genome-wide (global) scale Answers to questions about development, disease, evolution Whole Genome Mapping High Resolution Genetic Maps High resolution meiotic recombination maps High resolution cytogenetic maps Physical Genomic Maps “Ordered clones” or “Contigs” Sequence Maps (highest possible resolution) Bioinformatics Computational Analysis of Sequence information DNA and Protein Functional Genomics Experimental Analysis to determine the function of all genome components

High resolution genetic (meiotic recombination) maps What good are Genome Maps? Provide markers for finding location of genes (disease/developmental genes) Provide markers for assembling individual clones into whole chromosomes Why is high resolution necessary? Cytological or recombinational maps get you to within 1 Mb of gene High Reolustion means high density of Genetic Markers Genetic Markers = Polymorphisms Used in Mapping Genes Neutral DNA sequence variations (DNA polymorphisms) DNA polymorphisms RFLP (restriction fragment length polymorphisms) Simple Sequence Length Polymorphisms (SSLPs) Minisatellite sequences (aka VNTR = variable number of tandem repeats) Microsatellite sequences (aka STRs =Simple Tandom Repeats) RAPD (Randomly Amplified Polymorphic DNA) SNPs (Single Nucleotide Polymorphisms) Single nucleotide differences in the sequence of chromosomes between homologs; between individuals; high heterozygosity

Simple Sequence Length Polymorphisms: Minisattelites/VNTRs VNTR = variable number of tandem repeats one, two, three,…etc in “head to head” orientation (same orientation) sequences are 15 to 100 nucleotides long detected in restriction digests of genomic DNA by southern blots restriction fragments typically from 1 to 5 kb in length, with variation in length of fragment due to variation in the number of repeats each specific repeat will be found at multiple loci in a genome, so you detect alleles at multiple loci in one experiment Above shows VNTR/minisattelite repeat in an intron of a gene – four copies in this allele, other numbers in other alleles Next slide shows VNTR alleles at multiple loci and the expected southern blot results

Multiple Polymorphic Loci Identified by One Specific Repeat Cut genomic DNA and probe the blot with the repeat sequence Note: more than two alleles possible for any given locus and multiple loci identified by a single repeat All three individuals are heterozygotes at all three loci Typical high heterozygosity for VNTRs

Simple Sequence Length Polymorphisms: Microsattelite Repeats Tandem repeats of di or tri or tetra nucleotide sequences Two alleles at a locus example below: GTCTAGCACACACACACACACACACACAGTACGGAC GTCTAGCACACACACACACACACACACACACACACCAGTACGGAC As with VNTRs, multiple alleles possible (from zero to hundreds of copies) Detection by PCR using primers that hybridize to unique (non-repetitive) sequences that flank the microsattelite locus

Mapping using Microsattelites Results of PCR of a microsattelite locus of parents and progeny in a pedigree Four alleles detected Both parents are heterozygotes (high heterozygosity as with VNTRs) for different alleles Affected individual carries dominant marker P and M’’ and M’ alleles at this locus All affected progeny have M’’, none have M’; P appears to be linked to M’’ Chromosomes in parents: M’’ P M’’’ p M’ p M’’’’ p

Another Polymorphism: Detected as Randomly Amplified DNA Polymorphisms (RAPDs or Rapids) Alleles are detected by the chance (random) hybridization of small PCR primers to different positions in a genome When primers correspond to inverted repeats close together on a chromosome, they will produce small PCR products in a PCR reaction = this PCR product identifies one allele at that locus Some individuals will have a variation in one of these sequences and so will not generate that PCR product = this is the alternate allele at that locus Example: 10 nucleotide long primers sequences occur 1/1 million bps on average or about 3000 times per the human genome. A few of these will be present as inverted repeats close together on one chromosomes and will yield PCR products.

Mapping with RADP RAPDs have to be heterozygous in one parent and absent from the other to be useful for mapping Example = mother above has two RAPDs not present in father and not present in all progeny – so mother is heterozygous for this RAPD Linkage of any trait to this RAPD can be checked in a cross or analysis of a pedigree (do problem # 3 to practice using RAPD to map traits in a haploid)

High resolution genetic (meiotic recombination) maps What good are Genome Maps? Provide markers for finding location of genes (disease/developmental genes) Provide markers for assembling individual clones into whole chromosomes Why is high resolution necessary? Cytological or recombinational maps get you to within 1 Mb of gene High Reolustion means high density of Genetic Markers Genetic Markers = Polymorphisms Used in Mapping Genes Neutral DNA sequence variations (DNA polymorphisms) DNA polymorphisms RFLP (restriction fragment length polymorphisms) Simple Sequence Length Polymorphisms (SSLPs) Minisatellite sequences (aka VNTR = variable number of tandem repeats) Microsatellite sequences (aka STRs =Simple Tandom Repeats) RAPD (Randomly Amplified Polymorphic DNA) SNPs (Single Nucleotide Polymorphisms) Single nucleotide differences in the sequence of chromosomes between homologs; between individuals; high heterozygosity

High Resolution Cytogenetic maps Cytogenetic Map: location of genes/DNA sequences on specific, cytologically detectable sites of a chromosome - DNA probes corresponding to RFLPs, Microsattellites, Cloned Genes - Determie their location on which Chromosomes where on the chromosomes relative to bands, centromere, telomere or other cytological marker Example above: map of human chromosome 1 and position of molecular markers Techniques: In Situ Hybridization Mapping FISH (fluorescence in situ hybridization) Rearrangement Breakpoint Mapping Radiation Hybrid Mapping

Locus Map Position Designated by G-band numbering terminology 1)chrom. number 2)arm designation Highest Band Resolution From prophase Or prometaphase Chromosomes 3)region numbers 5)sub-band numbers 4)band numbers 13.1 = Region 1 Band 3 Sub-band 1 Complete designation = 5p13.1 Xq26

In Situ Hybridization Mapping Probe = DNA labeled with fluorescent molecule Hybridize to chromosomes prepared for cytology Example application: what is the location of ACTN2 Gene? chromosome is - probe = cloned ACTN2 DNA - chromosomes = G-banded human chromosomes - four fluorescent dots appear both sister chromatids of both homologs of chromosome 1 dots are located at 1q42.2 Example above: DNA stained with red dye; fluorescent probe = yellow - less resolution than G banding but still tells you probe corresponds to a single copy sequence which chromosome (when you do it a lot) the approximate location is near the centromere

Chromosome Painting Chromosome Painting is similar to G-banding for cytological mapping Instead of Identifying chromosomes by size, structure, and banding pattern buy sets of probes that hybridize to different regions of each chromosome in pre-determined patterns Label you probe (gene, RFLP probe, minisattellite probe) with a color different from those in the set Hybridize and determine location as before Resolution can be similar to G-banding Above shows a chromosome paint display of a human karyotype (note that pictures of each chromosome pair have been cut out and placed next to each other in a tabular format)

Genomics Genetic Analysis on a Genome-wide (global) scale Answers to questions about development, disease, evolution Whole Genome Mapping High Resolution Genetic Maps High resolution meiotic recombination maps High resolution cytogenetic maps In situ Hybridization On G banded or “Painted” chromosomes Rearrangement Breakpoint Mapping Radiation Hybrid Mapping Physical Genomic Maps “Ordered clones” or “Contigs” Ordering by fingerprinting Sequence Maps (highest possible resolution) Bioinformatics Computational Analysis of Sequence information DNA and Protein Functional Genomics Experimental Analysis to determine the function of all genome components

Rearrangement Breakpoint Mapping Use Chromosomes from individuals with chromosome translocations - piece of two chromosomes break and switch places - example: end of chromosome 1 is replace by end of chromosome 2 and visa versa - translocation is detectable by G-banding or chromosome painting Mapping can be done by southern blot or by in situ hybridization Mapping by southern blot (a above): - use probes as before (genes or neutral DNA variations) select probes already located on appropriate chromosome looking for probe - probe southern blot of DNA from WT cells and cells containing the translocation - look for probe hybridizing to one band in WT and 2 bands in translocation Mapping by in situ hybridization (b above): - look for probes that hybridize to 2 different chromosomes (1 and 2 in above example)

Radiation Hybrid Mapping (RH) #s = loci on several Human chromosomes X-rays break all the chromosomes Into fragments Radiation Hybrid Mapping is used to look for physical linkage of two markers Hybrid Mapping based on finding that fragment of human chromosomes will randomly recombine with rodent chromosomes - Fragment human chromosomes by irradiating human cells in culture - Fuse irradiated human cells with mouse cells - Multiple mouse cells lines containing different, random fragments (6 to 12) of human chromosomes are established - DNA from each line is isolated and probed with the two markers in question If not linked, the frequency of both markers in one cell line (frequency of co-retention) will be the same as the product of their overall frequencies - probe A in 10% of cell lines, probe B in 10%; - probe A and B in same cell line = 10% x 10% = 1 % If linked, the frequency of co-retention will be significantly higher - probe A and B in same cell line ~ 10 & if tightly linked - calculate linkage by cR = 100 (1-freq of co-retention); cR = 1 = 0.1cM Only tightly- Linked loci Co- Some fragment integrate (recombine) with mouse Chromosomes These fragments are “retained” 2 loci retained in the same cell are co-retained

Physical Maps QR UV AB JK JK MO UV YZ MO QR AB JK JK MO MO QR QR UV Ordered clones or Contigs Ordered by Fingerprints Ordered by STSs (Sequence Tagged Sites) Eventually span an entire chromosome Use large clones (BACs, YACs or PACs) YACs = yeast artificial chromosomes (1000 kb) BACs = bacterial artificial chromosomes (300kb) PACs = P1 Bacteriophage artificial chromosomes (100 kb) Order clones by mapping each clone (MARKERS! RE SITES!) aligning maps of each clone as shown above and in your text alignment is a CONTIG Using restriction sites to generate a fingerprint… AB JK JK MO MO QR QR UV UV YZ

Using Fingerprints to Align Clones into Contigs Digest each clone with same RE that cuts many times Analyze digest by gel electrophoresis and staining DNA Look for multiple common bands in clones Can use automated statistical analysis to determine the likelihood that the bands are the same because the clones overlap Assemble the contig Notice that clone D is not in this contig, whereas A, B and C clones align as shown.

Using STS Content Mapping to order Clones into Contigs (STS = Sequence Tagged Sites) A contains 2, 11, 12 B contains 4, 7, 5, 6 C contains 1, 2, 8, 10 D contains 12, 3, 4, 7 E contains 1, 9, 8 Sequence Tagged Sites are Unique DNA Sequences - short (100 to 500 bp) - present only once in a genome Parts of single-copy genes Other fragments containing unique demonic DNA sequences Detect STSs by PCR - know sequence - order oligonucleotide primers for PCR - perform PCR on all the PAC or BAC or YAC clones - if product obtained, STS is present in that clone - if product is not obtained, STS is absent from it You now know the STSs present on each clone If STSs are present in two different clones, then the clones overlap (they share a MARKER) Overlap all the clones as shown above – now have a physical map of this region

Isolating Genes from Ordered DNA Libraries Ordered clones can eventually cover the entire genome of an organism Example above is ordered YAC clones covering every part of every C. elegans chromosome Each YAC clone is grown on the filter it TWO places Probe for gene X hybridized to membrane Autoradiography results in image on the right A “real” result is recognized by there being two dots corresponding to two colonies carrying the same YAC clone (false positive sometimes occur because of impurities or smudges on the membrane, but never in two places that correspond to two colonies of the same clone!) That YAC clone is numbered and is known to correspond to a specific place o a specific chromosome Now gene X is mapped and can be isolated from the YAC clone for further studies

Subdividing the Genome Will not cover this Has to do with making libraries of individual chromosomes or fragments of chromosomes instead of the whole genome Gets around some biological and technical limitations of the technology Biological and Technical Challenges to whole genome mapping Large duplication of genome confuse mapping Large regions of genome are not clonable Above results in contigs that are only part of whole chromosomes Chromosome-specific genomic libraries Isolation of individual chromosomes Ordering clones by FISH

Sequencing the Genome Consensus Sequence Assembly Ordered Clone Sequencing Whole Genome Shotgun Sequencing Sequence Contig Assembly Problems Caused by Repetitive DNA Tackling Problems caused by Repetitive DNA

Goal of the projects: Determine entire sequence of each and every chromosome in a genome Automated Production Line used in Genome Projects - Lots of repetitive labor, robots are cheaper and faster and don’t get tired or bored or form labor unions Process: - Sequence small segments of one strand of DNA (up to 800 nucleotides at a time) called a “SEQUENCING READ” or just a “READ” - Each READ must overlap other READS so that you can assemble contigs in the same manner as for ordered clones - Technical difficulties cause less than 100% accuracy in a READ - Each READ usually includes ambiguous or incorrect results for one or more positions in the 800 bp sequence - the sequencing result is not clear, for example, the READ may be, AGCTACT then either A or G, then TCGTAGATC - or the clone being sequenced was mutated during cloning and has the wrong nucleotide at one or more positions - Compensate by sequencing each place in the genome 10 times (10 times coverage) and generating a CONSENSUS SEQUENCE from those results

Generating Consensus Sequences from Individual READS AGCTATAACGCGGGATTGATCCTAGGGATCCTGCA READ 1 AGCTTTAAC?CGGGATTGATCCTAGGGATCCTGCA READ 2 AGCTTTAACGCGGGATTGAGCCTA???????TGCA READ 3 AGCTTTAACGAGGGATTGATCCTAGGGATCCTGCA READ 4 AGCTTTAACGCGGGATTGATCCTAGGGATCGTGCA READ 5 AGCTTTAAC?CGGGATTGATCCTAGGCATCCTGCA READ 6 AGCTTTAAC????GATTGTTCCTAGGGATCCTGCA READ 7 AACTTTAACGCGGGATTGATCCTAGGGATCCTGCA READ 8 AGCTTTTACGCGGGATTGATCCTAGGGATCCTGCA READ 9 AGCTTTAACGC??GATTGATCCTAGGGATCCTGCA READ 10 AGCTTTAACGCGGGATTGATCCTAGGGATCCTGCA Consensus

Insert C Insert A Vector Vector Insert D Insert B Vector Vector RE Insert A RE Vector Primer 2 Primer 1 Vector Insert D Insert B Using plasmid vectors to sequence small pieces of cloned genomic DNA Sequencing by Dideoxy Method (CH 8) Requires a primer for initiating DNA synthesis Use primers that hybridize to Plasmid Vectors sequences that flank the insert Sequence starts in the vector and then continues into the insert Two READS from each clone - “PAIRED READ ENDS” Genome Sequencing Strategies: Ordered Clone Sequencing versus Whole Genome Shotgun Sequencing Difference is whether or not you construct a physical map of ordered clones covering each chromosome - Ordered Clone Sequencing - when you are done sequencing, you are done! - Construct physical map of overlapping BAC (or PAC or YAC... Clones) - Sequence each of these clones completely - Assemble a contig from all the sequences Whole Genome Shotgun Sequencing: - when you are done sequencing, you still need to assemble contigs - REPETITIVE DNA MAKES THIS DIFFICULT - make libraries of whole genome in plasmid vectors - sequence all the clones until you’ve covered all segments of the genome 10 times Primer 2 Vector Primer 2 Vector Primer 1 Primer 1