C E N T R F O I G A V B M S U 2MNW/3I/3AI/3PHAR bachelor course Introduction to Bioinformatics Lecture 1: Introduction Centre for Integrative Bioinformatics.

Slides:



Advertisements
Similar presentations
What is Biophysics? Short answer: Application of physics methods to biological systems. To get a better perspective, we consider a very brief history of.
Advertisements

Master Course Sequence Analysis Anton Feenstra, Bart van Houte, Walter Pirovano, Jaap Heringa Tel , Rm.
Collaborative Information Management: Advanced Information Processing in Bioinformatics Joost N. Kok LIACS - Leiden Institute of Advanced Computer Science.
Introduction to Bioinformatics Yana Kortsarts Bob Morris.
Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Integrative Bioinformatics Institute VU (IBIVU) Tel ,
Bioinformatics at IU - Ketan Mane. Bioinformatics at IU What is Bioinformatics? Bioinformatics is the study of the inherent structure of biological information.
Bioinformatics Master’s Course Genome Analysis ( Integrative Bioinformatics ) Lecture 1: Introduction Centre for Integrative Bioinformatics VU (IBIVU)
Master’s course Bioinformatics Data Analysis and Tools Lecture 1: Introduction Centre for Integrative Bioinformatics FEW/FALW C E N T.
UNIT 4 BIOLOGY Continuity and Change: Genetics and Evolution.
. Class 1: Introduction. The Tree of Life Source: Alberts et al.
The Golden Age of Biology DNA -> RNA -> Proteins -> Metabolites Genomics Technologies MECHANISMS OF LIFE Health Care Diagnostics Medicines Animal Products.
Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
Data-intensive Computing: Case Study Area 1: Bioinformatics B. Ramamurthy 6/17/20151.
Lecture 1 BNFO 240 Usman Roshan. Course overview Perl progamming language (and some Unix basics) Sequence alignment problem –Algorithm for exact pairwise.
Course Sequence Analysis for Bioinformatics Master’s Bart van Houte, Radek Szklarczyk, Walter Pirovano, Jaap Heringa
Master Course Sequence Analysis Anton Feenstra, Bart van Houte, Radek Szklarczyk, Walter Pirovano, Jaap Heringa Tel.
Scientific Data Mining: Emerging Developments and Challenges F. Seillier-Moiseiwitsch Bioinformatics Research Center Department of Mathematics and Statistics.
BI420 – Course information Web site: Instructor: Gabor Marth Teaching.
Medical Informatics Basics
Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.
Meer perspectief Master’s programme in Bioinformatics Bio-tools for the Future International 2-year Bioinformatics Master’s Programme.
9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.
Bioinformatics.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
CSE 6406: Bioinformatics Algorithms. Course Outline
Master’s course Bioinformatics Data Analysis and Tools Lecture 1: Introduction Centre for Integrative Bioinformatics FEW/FALW
A brief Introduction to Bioinformatics Y. SINGH NELSON R. MANDELA SCHOOL OF MEDICINE DEPARTMENT OF TELEHEALTH Content licensed under.
C E N T R F O I G A V B M S U 2MNW/3I/3AI/3PHAR bachelor course Introduction to Bioinformatics Lecture 1: Introduction Centre for Integrative Bioinformatics.
Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.
Introduction to Bioinformatics Yana Kortsarts References: An Introduction to Bioinformatics Algorithms bioalgorithms.info.
CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.
Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Centre for Integrative Bioinformatics VU (IBIVU) Tel ,
Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.
DIALing the IBIVU Vrije Universiteit Amsterdam Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU) Faculty of Sciences / Faculty of Earth and.
Course Sequence Analysis for Bioinformatics Master’s Bart van Houte, Radek Szklarczyk, Victor Simossis, Jens Kleinjung, Jaap Heringa
California Content Standards
Overview of Bioinformatics 1 Module Denis Manley..
Central dogma: the story of life RNA DNA Protein.
EB3233 Bioinformatics Introduction to Bioinformatics.
© Copyright 2010 Robert D. Conway All Rights Reserved Who Invented It? The Controversial History of Technology and Invention
Introduction to Bioinformatics Algorithms Algorithms for Molecular Biology CSCI Elizabeth White
1 From Mendel to Genomics Historically –Identify or create mutations, follow inheritance –Determine linkage, create maps Now: Genomics –Not just a gene,
Applied Bioinformatics Dr. Jens Allmer Week 1 (Introduction)
Evolution and the Foundations of Biology
Introduction to molecular biology Data Mining Techniques.
BME435 BIOINFORMATICS.
Bioinformatics Overview
How DNA Works: Structure and Functions
Introduction to Bioinformatics and Functional Genomics
Data-intensive Computing: Case Study Area 1: Bioinformatics
Introduction to Bioinformatics February 13, 2017
Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,
생물정보학 Bioinformatics.
M.B.Ch.B, MSC, DCH (UK), MRCPCH
Deoxyribonucleic Acid
Genome organization and Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Bioinformatics Vicki & Joe.
Bioinformatics For MNW 2nd Year
The Study of Biological Information
The genetic material of our bodies.
Introduction to Bioinformatic
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Introduction to Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
SUBMITTED BY: DEEPTI SHARMA BIOLOGICAL DATABASE AND SEQUENCE ANALYSIS.
Reconfigurable Computing (EN2911X, Fall07)
DNA "The Blueprint of Life" DNA stands for... DeoxyriboNucleic Acid.
Presentation transcript:

C E N T R F O I G A V B M S U 2MNW/3I/3AI/3PHAR bachelor course Introduction to Bioinformatics Lecture 1: Introduction Centre for Integrative Bioinformatics VU (IBIVU) Faculty of Exact Sciences / Faculty of Earth and Life Sciences http://ibi.vu.nl, heringa@few.vu.nl, 87649 (Heringa), Room R4.41

Other teachers in the course Elena Marchioro, UD (15/4/2006) Anton Feenstra, Postdoc (1/09/05) Bart van Houte – PhD (1/09/04) Walter Pirovano – PhD (1/09/05) Radek Szklarczyk - PhD (1/01/03)

Introduction to Bioinformatics course content Pattern recognition Supervised/unsupervised learning Types of data, data normalisation, lacking data Search image Similarity/distance measures Clustering Principal component analysis

Introduction to Bioinformatics course content Protein Folding Structure and function Protein structure prediction Secondary structure Tertiary structure Function Post-translational modification Prot.-Prot. Interaction -- Docking algorithm Molecular dynamics/Monte Carlo

Introduction to Bioinformatics course content Sequence analysis Pairwise alignment Dynamic programming (NW, SW, shortcuts) Multiple alignment Combining information Database/homology searching (Fasta, Blast, Statistical issues-E/P values)

Introduction to Bioinformatics course content Gene structure and gene finding algorithms Genomics Sequencing projects Expression data, Nucleus to ribosome, translation, etc. Proteomics, Metabolomics, Physiomics Databases DNA, EST Protein sequence (SwissProt) Protein structure (PDB) Microarray data Proteomics Mass spectrometry/NMR/X-ray

Gathering knowledge Anatomy, architecture Dynamics, mechanics Informatics (Cybernetics – Wiener, 1948) (Cybernetics has been defined as the science of control in machines and animals, and hence it applies to technological, animal and environmental systems) Genomics, bioinformatics Rembrandt, 1632 Newton, 1726

Bioinformatics Bioinformatics Chemistry Biology Mathematics Molecular Statistics Bioinformatics Computer Science Informatics Medicine Physics

Bioinformatics “Studying informational processes in biological systems” (Hogeweg, early 1970s) No computers necessary Back of envelope OK “Information technology applied to the management and analysis of biological data” (Attwood and Parry-Smith) Applying algorithms with mathematical formalisms in biology (genomics) Not good: biology and biological knowledge is crucial for making meaningful analysis methods!

Bioinformatics in the olden days Close to Molecular Biology: (Statistical) analysis of protein and nucleotide structure Protein folding problem Protein-protein and protein-nucleotide interaction Many essential methods were created early on (BG era) Protein sequence analysis (pairwise and multiple alignment) Protein structure prediction (secondary, tertiary structure)

Bioinformatics in the olden days (Cont.) Evolution was studied and methods created Phylogenetic reconstruction (clustering – e.g., Neighbour Joining (NJ) method)

But then the big bang….

The Human Genome -- 26 June 2000

The Human Genome -- 26 June 2000 “Without a doubt, this is the most important, most wondrous map ever produced by humankind.” U.S. President Bill Clinton on 26 June 2000 during a press conference at the White House.

The Human Genome -- 26 June 2000 Dr. Craig Venter Celera Genomics -- Shotgun method Francis Collins (USA)/ Sir John Sulston (UK) Human Genome Project

Human DNA There are at least 3bn (3  109) nucleotides in the nucleus of almost all of the trillions (3.2  1012 ) of cells of a human body (an exception is, for example, red blood cells which have no nucleus and therefore no DNA) – a total of ~1022 nucleotides! Many DNA regions code for proteins, and are called genes (1 gene codes for 1 protein as a base rule, but the reality is a lot more complicated) Human DNA contains ~26,000 expressed genes Deoxyribonucleic acid (DNA) comprises 4 different types of nucleotides: adenine (A), thiamine (T), cytosine (C) and guanine (G). These nucleotides are sometimes also called bases

Human DNA (Cont.) All people are different, but the DNA of different people only varies for 0.1% or less. Evidence in current genomics studies (Single Nucleotide Polymorphisms or SNPs) imply that on average only 1 letter out of 1400 is different between individuals. Over the whole genome, this means that 2 to 3 million letters would differ between individuals. The structure of DNA is the so-called double helix, discovered by Watson and Crick in 1953, where the two helices are cross-linked by A-T and C-G base-pairs (nucleotide pairs – so-called Watson-Crick base pairing).

Modern bioinformatics is closely associated with genomics The aim is to solve the genomics information problem Ultimately, this should lead to biological understanding how all the parts fit (DNA, RNA, proteins, metabolites) and how they interact (gene regulation, gene expression, protein interaction, metabolic pathways, protein signalling, etc.) Genomics will result in the “parts list” of the genome

Translational Medicine “From bench to bed side” Genomics data to patient data Integration

Functional Genomics From gene to function TERTIARY STRUCTURE (fold) Genome Expressome Proteome Metabolome Functional Genomics From gene to function

Systems Biology is the study of the interactions between the components of a biological system, and how these interactions give rise to the function and behaviour of that system (for example, the enzymes and metabolites in a metabolic pathway). The aim is to quantitatively understand the system and to be able to predict the system’s time processes the interactions are nonlinear the interactions give rise to emergent properties, i.e. properties that cannot be explained by the components in the system

Systems Biology understanding is often achieved through modeling and simulation of the system’s components and interactions. Many times, the ‘four Ms’ cycle is adopted: Measuring Mining Modeling Manipulating

A system response Apoptosis: programmed cell death Necrosis: accidental cell death

Neuroinformatics Understanding the human nervous system is one of the greatest challenges of 21st century science. Its abilities dwarf any man-made system - perception, decision-making, cognition and reasoning. Neuroinformatics spans many scientific disciplines - from molecular biology to anthropology.

Neuroinformatics Main research question: How does the brain and nervous system work? Main research activity: gathering neuroscience data, knowledge and developing computational models and analytical tools for the integration and analysis of experimental data, leading to improvements in existing theories about the nervous system and brain. Results for the clinic: Neuroinformatics provides tools, databases, models, networks technologies and models for clinical and research purposes in the neuroscience community and related fields.