(codes for amino acids) A gene is composed of two parts: ON OFF regulatory region (on/off switch) coding region (codes for amino acids)

Transcription factors turn genes on and off. Transcription factors are proteins that bind to a specific base sequence in DNA. …AGCCTACCAAAAAAGGTTCCACG… …TCGGATGGTTTTTTCCAAGGTGC…

(codes for amino acids) Some transcription factors are activators: They turn genes ON. regulatory region (on/off switch) coding region (codes for amino acids)

(codes for amino acids) Some transcription factors are activators: They turn genes ON. - Some transcription factors are repressors: They turn genes OFF. regulatory region (on/off switch) coding region (codes for amino acids)

Concepts 1. What is a mutant? 2. How is hereditary information passed on from one generation to the next? What are the rules? 3. The same rules apply to all plants and animals.

Normal Fly

White Eyes Mutant

Dark Body Mutant

Tiny Wing Mutant

Wings Held-Out Mutant

What is a mutant? A mutant is different than “normal”. The mutant characteristic is passed on to the next generation.

Fruit Flies normal wing mutant

normal wing mutant

Genes Genes are the basic units of inheritance. Plants and animals have two copies of every gene. Mom and dad each pass on only one copy of every gene to their children.

Genes Genes can be working (“good”) or broken (“bad”). One “good” copy of a gene is all that is needed to be normal. A mutant has two “bad” copies of a gene.

+/+ +/+ x x Each offspring gets one copy of the gene from each parent. normal (has 2 good copies of wing gene) +/+ x parents: +/+ offspring: Each offspring gets one copy of the gene from each parent. All offspring are normal.

-/- -/- x x Each offspring gets one copy of the gene from each parent. wingless mutant (has 2 bad copies of wing gene) -/- x parents: -/- offspring: Each offspring gets one copy of the gene from each parent. All offspring have 2 bad copies of wing gene. All offspring are wingless.

+/+ -/- +/- x x All offspring look normal because they only (has 2 good copies of wing gene) mutant (has 2 bad copies +/+ -/- x parents: +/- offspring: All offspring look normal because they only need one good copy of the wing gene. All offspring are “carriers” for a mutant copy of the wing gene.

+ / - +/+ +/- -/+ -/- x x carrier carrier offspring: These flies look normal because they only need one good copy of the wing gene. These flies have no wings because they have two bad copies of the wing gene.

Cells Communicate with Each Other Through Signals and Receptors

Cells Communicate with Each Other Through Signals and Receptors Some signals are secreted and can travel several cells away.

Cells Communicate with Each Other Through Signals and Receptors Some signals are tethered and can only influence adjacent cells.

Cells Communicate with Each Other Through Signals and Receptors Receptors sense signals and become activated. Activated receptors act to alter gene expression.

A Morphogen is a Developmentally Important Type of Secreted Signal Morphogens have the following characteristics: 1. They are synthesized in some but not all cells. 2. They diffuse from the site of synthesis and are less concentrated the farther away from the source of synthesis. 3. Cells respond to different morphogen concentrations by activating expression of distinct sets of genes.

Morphogens

The dpp gene promotes skin development. In dpp mutants, skin is replaced by nervous system.

The dpp gene is normally expressed in cells that will form skin. What would happen if the dpp gene was misexpressed in cells that would normally form the nervous system?

Misexpression Experiment Normal embryo Dorsal Ventral Misexpression of dpp converts cells that would normally form nervous system into skin.

The ag gene promotes stamen development stamen petal normal ag mutant In ag mutants, stamens are replaced by petals.

The ag gene is normally expressed in stamens ag mutant What would happen if the ag gene was misexpressed in cells that would normally form petals?

Misexpression Experiment normal ag mutant ag misexpression Misexpression of ag causes cells that would normally form petals to form stamens.