Ecclesiastes 3:1 1 To every thing there is a season, and a time to every purpose under the heaven:

Initiation of Transcription Timothy G. Standish, Ph. D.

All Genes Can’t be Expressed At The Same Time Some gene products are needed by all cells all the time. These constitutive genes are expressed by all cells. Other genes are only needed by certain cells or at specific times, expression of these inducible genes is tightly controlled in most cells. For example, pancreatic b cells make insulin by expressing the insulin gene. If neurons expressed insulin, problems would result.

Operons Are Groups Of Genes Expressed By Prokaryotes The genes grouped in an operon are all needed to complete a given task Each operon is controlled by a single control sequence in the DNA Because the genes are grouped together, they can be transcribed together then translated together

The Lac Operon Genes in the lac operon allow E. coli bacteria to metabolize lactose Lactose is a sugar that E. coli is unlikely to encounter. Production of lactose metabolizing enzymes when not needed would be wasteful Metabolizing lactose for energy only makes sense when two criteria are met: Other more readily metabolized sugar (glucose) is unavailable Lactose is available

The Lac Operon - Parts The lac operon is made up of a control region and four genes The four genes are: LacZ - b-galactosidase - Hydrolizes the bond between galactose and glucose LacY - Codes for a permease that lets lactose across the cell membrane LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain Repressor - A protien that works with the control region to control expression of the operon

The Lac Operon - Control The control region is made up of two parts: Promoter These are specific DNA sequences to which RNA Polymerase binds so that transcription can occur The lac operon promoter also has a binding site for another protein called CAP Operator The binding site of the repressor protein The operator is located down stream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe

The Lac Operon: When Glucose Is Present But Not Lactose Come on, let me through Repressor mRNA Hey man, I’m constitutive RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding Repressor No way Jose! Repressor CAP

The Lac Operon: When Glucose And Lactose Are Present Great, I can transcribe! Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding X Repressor Repressor Lac This lactose has bent me out of shape Repressor CAP Some transcription occurs, but at a slow rate

The Lac Operon: When Lactose Is Present But Not Glucose Bind to me Polymerase Yipee…! Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding CAP cAMP X Repressor Repressor CAP cAMP Lac Repressor This lactose has bent me out of shape CAP cAMP

The Lac Operon: When Neither Lactose Nor Glucose Is Present Alright, I’m off to the races . . . Bind to me Polymerase Repressor mRNA Hey man, I’m constitutive Come on, let me through! RNA Pol. Repressor Promoter LacY LacA LacZ Operator CAP Binding CAP cAMP STOP Right there Polymerase CAP cAMP CAP cAMP

The Trp Operon Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan Enzymes encoded by genes in the trp operon are all involved in the biochemical pathway that converts the precursor chorismate to tryptophan. The trp operon is controlled in two ways: Using a repressor that works in exactly the opposite way from the lac operon repressor Using a special attenuator sequence

The Tryptophan Biochemical Pathway COO- H CH2 C HO O Chorismate O -OOC OH HN H -2O3P CH2 5-Phosphoribosyl- a-Pyrophosphate PPi N-(5’- Phosphoribosyl) -anthranilate Antrhanilate COO- NH2 Glutamate + Pyruvate Glutamine Anthranilate synthetase (trpE and D) N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) Tryptophan synthetase (trpB and A) N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase -OOC OH -2O3PO CH2 N H C Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate CO2+H2O -2O3PO CH2 C H OH N Indole-3-glycerol phosphate Glyceraldehyde- 3-phosphate N H Indole N H -OOC CH2 NH3+ C Tryptophan H2O Serine

The Trp Operon: When Tryptophan Is Present Repressor mRNA Hey man, I’m constitutive Foiled Again! RNA Pol. Repressor Promo. trpD trpB Lead. Operator trpA trpC trpE Aten. Trp Repressor STOP Right there Polymerase Repressor Trp

The Trp Operon: When Tryptophan Is Absent Repressor mRNA Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor Promo. trpD trpB Lead. Operator trpA trpC trpE Aten. Repressor needs his little buddy tryptophan if I’m to be stopped Repressor I need tryptophan

Attenuation The trp operon is controlled both by a repressor and attenuation Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes

Transcription And Translation In Prokaryotes 3’ 5’ 5’ mRNA RNA Pol. Ribosome Ribosome

The Trp Leader and Attenuator Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU-UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA-AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA-AAA-CCG trpE . . . Terminator 4 1 2 3

The mRNA Sequence Can Fold In Two Ways 4 1 2 3 4 1 2 3 Terminator haripin

The Attenuator When Starved For Tryptophan 3’ 5’ Ribosome RNA Pol. Help, I need Tryptophan 4 1 2 3

The Attenuator When Tryptophan Is Present 3’ 5’ 4 1 2 3 Ribosome RNA Pol. RNA Pol.

Expression Control In Eukaryotes Some of the general methods used to control expression in prokaryotes are used in eukaryotes, but nothing resembling operons is known Eukaryotic genes are controlled individually and each gene has specific control sequences preceding the transcription start site In addition to controlling transcription, there are additional ways in which expression can be controlled in eukaryotes

Eukaryotes Have Large Complex Geneomes The human genome is about 3 x 109 base pairs or ≈ 1 m of DNA Because humans are diploid, each nucleus contains 6 x 109 base pairs or ≈ 2 m of DNA Some gene families are located close to one another on the same chromosome Genes with related functions appear to be distributed almost at random throughout the the genome

Highly Packaged DNA Cannot be Expressed Because of its size, eukaryotic DNA must be packaged Heterochromatin, the most highly packaged form of DNA, cannot be transcribed, therefore expression of genes is prevented Chromosome puffs on some insect chomosomes illustrate areas of active gene expression

Only a Subset of Genes is Expressed at any Given Time It takes lots of energy to express genes Thus it would be wasteful to express all genes all the time By differential expression of genes, cells can respond to changes in the environment Differential expression, allows cells to specialize in multicelled organisms. Differential expression also allows organisms to develop over time.

Control of Gene Expression DNA Cytoplasm Nucleus Nuclear pores Packaging Degradation RNA Transcription Modification Ribosome Translation Transportation G AAAAAA RNA Processing mRNA Degradation etc. G AAAAAA G AAAAAA Export

Logical Expression Control Points DNA packaging Transcription RNA processing mRNA Export mRNA masking/unmasking and/or modification mRNA degradation Translation Protein modification Protein transport Protein degradation Increasing cost The logical place to control expression is before the gene is transcribed

Three Eukaryotic RNA Polymerases RNA Polymerase I - Produces rRNA in the nucleolus, accounts for 50 - 70 % of transcription RNA Polymerase II - Produces mRNA in the nucleoplasm - 20 - 40 % of transcription RNA Polymerase III - Produces tRNA in the nucleoplasm - 10 % of transcription

A “Simple” Eukaryotic Gene Transcription Start Site 5’ Untranslated Region 3’ Untranslated Region Introns 3’ 5’ Exon 2 Exon 3 Int. 2 Exon 1 Int. 1 Promoter/ Control Region Exons Terminator Sequence RNA Transcript

Enhancers 5’ 3’ 3’ 5’ TF TF 3’ 5’ TF DNA Many bases Enhancer Promoter Transcribed Region TF 3’ 5’ TF TF 3’ 5’ TF RNA Pol. 5’ RNA Pol.

Eukaryotic RNA Polymerase II RNA polymerase is a very fancy enzyme that does many tasks in conjunction with other proteins RNA polymerase II is a protein complex of over 500 kD with more than 10 subunits:

Eukaryotic RNA Polymerase II Promoters Several sequence elements spread over about 200 bp upstream from the transcription start site make up RNA Pol II promoters Enhancers, in addition to promoters, influence the expression of genes Eukaryotic expression control involves many more factors than control in prokaryotes This allows much finer control of gene expression

Initiation T. F. Promoter RNA Pol. II T. F. T. F. RNA Pol. II 5’ mRNA

Exon 1 5’ Eukaryotic Promoters Promoter TATA Sequence elements SSTATAAAASSSSSNNNNNNNNNNNNNNNNNYYCAYYYYYNN S = C or G Y = C or T N = A, T, G or C ~200 bp Transcription start site “TATA Box” Initiator (Template strand) -1+1 ~-25

Initiation TFIID Binding TBP Associated Factors (TAFs) Transcription start site “TATA Box” -1+1 TATA Binding Protein (TBP)

Initiation TFIID Binding Transcription start site TFIID 80o Bend -1+1

Initiation TFIIA and B Binding Transcription start site TFIID TFIIB -1+1 TFIIA

Initiation TFIIF and RNA Polymerase Binding Transcription start site TFIID TFIIB -1+1 TFIIA TFIIF RNA Polymerase

Initiation TFIIE Binding Transcription start site TFIIE TFIID TFIIF RNA Polymerase TFIIB -1+1 TFIIA TFIIE has some helicase activity and may by involved in unwinding DNA so that transcription can start

Initiation TFIIH and TFIIJ Binding Transcription start site TFIIE TFIID TFIIH TFIIF RNA Polymerase TFIIB P -1+1 TFIIA TFIIH has some helicase activity and may by involved in unwinding DNA so that transcription can start

Initiation TFIIH and TFIIJ Binding Transcription start site TFIIE TFIID TFIIH TFIIF RNA Polymerase TFIIB P -1+1 TFIIA

Initiation TFIIH and TFIIJ Binding Transcription start site RNA Polymerase P -1+1

The End