Quiz #6 (8%) Biol710 11/19/12 name___________

Slides:

Advertisements

Similar presentations

Q Card Quiz What is……….. The basic function of DNA

Advertisements

Happy Friday! BELL WORK: Write the questions below AND your answers and highlight/underline key words: 1.What is the product of the process of TRANSLATION?

KEY WORDS – CELLS, DNA, INFORMATION All living things are made from Deoxyribonucleic acid is abbreviated This molecule stores that helps cells carry.

TRANSLATION The process of converting the information stored in mRNA into a protein is called translation mRNA carries information from a gene to a structure.

KEY WORDS – CELLS, DNA, INFORMATION All living things are made from Deoxyribonucleic acid is abbreviated This molecule stores that helps cells carry.

RNA and Protein Synthesis

Mutations Section 12–4 This section describes and compares gene mutations and chromosomal mutations.

Recall that with a GENE mutation, only one gene on the chromosome is affected. However, many genes are crucial for producing key enzymes and for controlling.

Chapter 6 Gene Prediction: Finding Genes in the Human Genome.

1. A mutation occurs at the midpoint of a gene, altering all amino acids encoded after the point of mutation. Which mutation could have produced this.

ATGGCAAAAGATCGTCGCAGTAATGAAGCTGAAAATATCGCTGTTGTTGAAAAACCGCTGAAATCGGACCG CTTCTTTA TCTCTGATGGTCTGCCGAGTCCGTTCGGCCCGACCGTTCGTGATGACGGTGTGAATTTTTCTGTTTATAGT.

Decoding the Gene. The Genetic Code is contained in a three- letter sequence called a codon. A codon consists of three consecutive nucleotides, which.

Tutorial -1: BB 101 (30/7/13) Q.1: The language of life is coded into two sets of alphabets. The genetic information which is coded in the DNA is read.

Protein Synthesis.

Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.

The Genetic Code. The DNA that makes up the human genome can be subdivided into information bytes called genes. Each gene encodes a unique protein that.

The Central Dogma The Central Dogma traces the flow of genetic information DNA Replication, Transcription, and Translation take place in human cells as.

DNA, RNA, PROTEIN REVIEW. 1. What are all living things made of? 2. In what organelle is the genetic material located? 3. What is the name of the molecule.

Exercise 3 Inspecting the primary structure of a gene.

Chapter 17 How to read a table of codons. These are two forms in which you might see a table of codons.

Ribosomes and Protein Synthesis. Learning Objectives  Identify the genetic code and explain how it is read.  Summarize the process of translation. 

Protein Synthesis. The genetic code This is the sequence of bases along the DNA molecule Read in 3 letter words (Triplet) Each triplet codes for a different.

The Central Dogma 12.3 HW tonight read 12.4 and review this stuff!

Sanger Method Frederick Sanger Radioactively labelled dNTPs or radioactive/fluorescent primers  Autoradiography, laser detector Chain Termination.

C acaatataATGGAGCGTGAGACTTCGTCATCTTCAACTCCTCCGGAGGATCTTGTTACATCGATGATCGGAAAGTTCGTCGCTGTCATGTCTA b acaatataATGGAGCGTGAGACTTCGTCATCTTCAACTCCTCCGGAGGATCTTGTTACATCGATGATCGGAAAGTTCGTCGCTGTCTTGTCTA.

DNA Structure and Protein Synthesis (also known as Gene Expression)

From DNA to Protein - Gene Expression: RNA and Protein

CH 12.3 RNA & Protein Synthesis.

The Central Dogma Transcription & Translation

Unit 4: Genetic Information, Variation and Relationships between Organisms Lesson 2 The Triplet Code A sequence of three DNA bases, called a triplet,

Gene Expression Continued

The making of proteins for …..

Transcription/Translation foldable

Quiz #7 (8%) Biol710 11/21/12 name___________

محاضرة عامة التقنيات الحيوية (هندسة الجينات .. مبادئ وتطبيقات)

Quiz#6 LC710 10/13/10 name___________

Transcription -The main purpose of transcription is to create RNA from DNA because RNA leaves the nucleus to carry out its functions but DNA does not -A.

Transfer of information from DNA

DNA Reflection After viewing and hearing your classmates presentations, and making you own, what do you specifically understand and what do you not specifically.

Mutations Mutations are changes in DNA.

Notes 13.1 DNA.

Bell ringer-General December 9, 2015

Quiz#4 LC710 11/14/11 name___________

Section: ___ Time of lab:______8th or 9th floor (circle)

RNA is a nucleic acid made of linked nucleotides.

Essential Question: How cells make proteins

RNA DNA Synthesis Mutations Protein Synthesis

January 11, 2018 Objective: Journal:

Quiz#6 LC710 10/13/10 name___________

How genes on a chromosome determine what proteins to make

Sources of Variation.

DNA & RNA Protein Synthesis.

RNA DNA Synthesis Mutations Protein Synthesis

Translation Decoding the message.

Have your clickers ready!

RNA is a nucleic acid made of linked nucleotides.

Making Proteins Transcription Translation.

Mutations changes in genetic material (_____).

GENE MUTATIONS.

Reading Frames and ORF’s

(1) It would stimulate mitotic cell division.

STAAR Notebook 2.

Reading mRNA and synthesizing protein

Testing Wednesday October 7, 2015 – DNA and RNA

Protein Synthesis.

Presentation transcript:

Quiz #6 (8%) Biol710 11/19/12 name___________ Q1: I have synthesized a gene for the following protein: MDLRQFLMCLSLCTAF and sequenced a subclone that carries it Write out the single letter sequence below the sequencing trace. Find and underline the Kozak sequence. 4% Given the following DNA sequencing run: G(black) A(green) T(red) C(blue)

Quiz #6 (8%) Biol710 11/19/12 name___________ Name two aspects of DNA sequencing technology that help make it possible to determine the position of each DNA nucleotide? (2%) _______________ Q3 Here is a codon usage table for an ORF. Does the codon usage table below suggest that it was generated by a scientist? If so, why? If not, why not? (2%)