What happens when the mRNA leaves the nucleus??

Slides:

Advertisements

Similar presentations

RNA and Protein Synthesis

Advertisements

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

RNA and Protein Synthesis

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

The Genetic Code.

CFE Higher Biology DNA and the Genome Translation.

BELLRINGER: Draw the following box and fill in the squares, THIRD box on the last bell-ringer page: REPLICATIONTRANSCRIPTION Where in the cell.

Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

 Watch these 2 animations and try to explain what is going on.  Animation 1 Animation 1  Animation 2 Animation 2.

Translation Section 11-2 cont.. Transcription Translation 20 different amino acids 20 different amino acids A group of three nucleotides in mRNA code.

Protein Synthesis: Transcription & Translation.

12.3 Protein Synthesis (Translation). Watch these animations and try to explain what is going on. ◦Animation 1Animation 1 ◦Animation 2Animation 2.

Review. Questions: What is a single unit of DNA called? Nucleotide What shape is DNA? Double Helix What are the four letters / bases in DNA? A, T, G,

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

Aim: How are proteins synthesized?

Notes: Transcription DNA vs. RNA

RNA and Protein Synthesis

Ribosomes and Protein Synthesis

RNA Another Nucleic Acid.

How to Make a Protein?.

Protein Synthesis.

Protein Synthesis.

RNA Another Nucleic Acid.

Transcription and Translation

RNA Another Nucleic Acid.

RNA and Protein Synthesis

RNA and Protein Synthesis

Protein Synthesis.

Old News TRANSCRIPTION: process that makes an _______ ___________ of DNA. RNA is ________________, and ___ is replaced by ___ (A-U; G-C) RNA___________________.

Interest Grabber Information, Please

How DNA and RNA make Proteins.

Answers for Transcription

Protein Synthesis: Translation

Chapter 12: From Genes to Proteins

Transcription & Translation.

Amino Acid Activation And Translation.

Bell Ringer What is the it called when we make a copy of mRNA from DNA? What is the RNA copied from the DNA chain ATTAAGCGAT? Why do we need RNA? What.

Big picture of protein synthesis

Biology Chapter 10 Section 1 Part 2

Protein Synthesis Step 2: Translation

Protein Synthesis Standards:

Ch. 12 Protein Synthesis.

Protein Synthesis.

Protein Synthesis Translation

RNA and Protein Synthesis

RNA - TRANSLATION.

Transcription Creation of RNA (ribose nucleic acid)

Translation and Transcription

I will understand the general pathway of transcription and translation

Translation Decoding the message.

Unit 7: Molecular Genetics

Ribosomes and Protein Synthesis

GENE EXPRESSION / PROTEIN SYNTHESIS

Ch Protein Synthesis Protein Synthesis Proteins are polypeptides

Higher Biology Unit 1: 1.3 Translation.

Translation AKA, Protein Synthesis Amino Acid Protein tRNA Nucleus

DNA carries the “code of life”

RNA, Protein Synthesis, Transcription, and Translation

Protein synthesis.

Transcription and Translation

Protein Synthesis - Making Proteins

The Protein-making Process

Do Now Describe the three types of RNA.

Protein Synthesis.

3 July 2019 P. 56 Complete Quick Lab p. 303 Compare and contrast:

Protein Synthesis.

Presentation transcript:

What happens when the mRNA leaves the nucleus?? It leaves the nucleus, goes through the cytoplasm until it attaches to a ribosome. Transcription is when the mRNA was made from DNA in the nucleus.

Translation Decoding of an mRNA message into a polypeptide chain (protein) Where does it start: AUG (aka a start codon)

The Process of Translation As each codon of mRNA moves through the ribosome the tRNA brings in a pairing amino acid. Each tRNA carries only 1 kind of amino acid.

Proteins Our proteins are made up of AMINO ACIDS. DNA: TACGCACATTTA mRNA: AUGCGUGUAAAU Protein: CODON: block of 3 mRNA bases

The mRNA Code Start Codon: AUG Methionine Stop Codon: UGA,UAA, UAG

If asked to find an anti-codon... Anti-Codon = block of 3 tRNA bases Anti-Codon would pair with mRNA AUGCGUGUA : mRNA UACGCACAU: Anti-Codon

Knowledge Check How many different kinds of bases can be found on DNA? What base is found on RNA but not DNA? How many bases are in a codon? In an anti-codon? How many amino acids are attached to a single transfer RNA? Transcription occurs in the ______________; Translation occurs in the________________. The process of making RNA from DNA is called _______________. The process of assembling a protein from RNA is called ________________________.

Together Then Your Turn

Translation Reading Pg 303-306 During translation the cell uses information from _____________ to produce ____________. Summarize A, B, C, & D from figure 12-18. Where does translation take place? Where is RNA released to? How does translation begin? What are the unpaired bases in tRNA called? How does the polypeptide chain know when to stop? Compare DNA & RNA to a construction site. What was Gregor Mendel surprised to learn? 12-3 Section Assessment Questions