Practice Base-Paring

Review What is the purpose of replication? Original strand: ATTCCG Complement: Original strand: GCTAAG Complementary strand: Original strand: CTACCA Original: Strand A: GACCTA Strand B: What is the purpose of replication? How does DNA serve as its own template?

RNA Transcription & Protein Synthesis From DNA to Proteins 2 Types of nucleic acid

DNA -> RNA -> Protein DNA- Life’s Code DNA -> RNA -> Protein

Central Dogma DNA  RNA  Protein Transcription DNA  RNA Translation

RNA and Protein Synthesis Why make proteins? Skin, muscles, nails, hair, hormones, enzymes How do we make proteins?

DNA makes RNA RNA is the 2nd type of Nucleic Acid RNA is made of nucleotides, just like DNA 1. Ribose is the sugar 2. Phosphate 3. Nitrogen Bases Adenine (A) Guanine (G) Cytosine (C) Uracil (U): NOT Thymine (T) Single Stranded When RNA is assembled based off of DNA’s pattern, this is called Transcription

RNA and Protein Synthesis Types: mRNA – messenger tRNA – transfer rRNA - ribosomal

3 Types of RNA

RNA and Protein Synthesis Comparing DNA and RNA DNA RNA SUGAR BASES STRUCTURE LOCATION Deoxyribose Ribose A T C G A U C G Double Helix Single Stranded Nucleus. Cytoplasm, Ribosomes Nucleus

Transcription Occurs in the nucleus DNA is again unzipped, this time by RNA Polymerase. Reversibly breaks Hydrogen bonds RNA Polymerase adds complementary RNA nucleotides Starting at a region called the promoter Ending at a terminator region This makes mRNA = messenger = carries the message mRNA leaves the nucleus DNA is too large to get out of the nucleus, RNA carries DNA’s message out of the nucleus to a ribosome. Ribosome – where the protein will be made. DNA

3 Stages of Transcription Write on bottom of your notes… 1. Initiation: RNA polymerase binds to the DNA at the promoter region. 2. Elongation: RNA polymerase moves along the coding strand of DNA, adding complementary RNA nucleotides, building the RNA transcript 3. Termination: RNA polymerase reaches the terminator region of the DNA and is released, DNA re-coils

RNA Polymerase makes mRNA RNA Polymerase breaks H-bonds Deoxy-ribose P Thymine Cytosine Adenine Ribose P Uracil Ribose P Guanine Uracil Adenine Adenine Deoxy-ribose P Guanine Thymine ---H--- Transcription Ribose P Guanine RNA Polymerase makes mRNA Strands move apart mRNA exits nucleus RNA Polymerase breaks H-bonds DNA re-coils ---H--- Ribose P Adenine ---H--- P

RNA complimentary base pairing during Transcription DNA strand = AATTTGCGCGGCT mRNA strand = DNA strand = TATGCGCACTG DNA strand = CGATCAGCCTAT

Fill in the missing information

Transcription

Transcription: RNA Editing Many RNA molecules require a bit of editing before they leave the nucleus. Introns- not involved in coding for proteins These get taken out in a process called splicing Exons- are expressed

Replication vs Transcription Given the DNA chain below, make the complementary DNA strand and the mRNA strand that would be transcribed: GGGCGTATTTAGCTAGACCCGAAACCC Answer the following questions: What is the purpose of DNA replication? Of Transcription? What is the final product of DNA replication? Of Transcription? Be Specific. What is the name of the enzymes(s) used in DNA replication? In transcription? Where does DNA replication occur in the cell? Transcription?

Translation RNA to Protein All 3 RNA work together to create a protein molecule Occurs at ribosomes (rRNA), tRNA act as carriers for Amino Acids Translation: sequence of mRNA is translated into the amino acid sequence of a protein (Polypeptides) String of amino acids held together by a peptide bond Sequence of mRNA nucleotides is broken into a series of codons, or a sequence of three nucleotides that codes for an amino acid. Examples: AUG= Methionine CUU= Leucine

The Genetic Code The genetic code translates the mRNA codon into an Amino Acid AUG= Start/Methionine UAA, UGA or UAG= Stop Codon GCA = Codon AAG = Codon CGA =

Translation Overview mRNA carries the DNA instructions for making protein mRNA enters the cytoplasm through nuclear pores mRNA attaches to a ribosome (rRNA) to be “read” Amino Acids are strung together (using tRNA) as ribosome “reads” mRNA to build a polypeptide chain Ribosome reaches stop codon and detaches from mRNA Same 3 steps as transcription Initiation Elongation Termination

Initiation Ribosome binds its P site to mRNA at start codon (AUG) Ribosome made of 3 sites: E site: tRNA prepares to exit after dropping off Amino Acid P site: newly arriving Amino Acid joins A site: next in line to be added

Elongation Transfer RNA (tRNA) carrying Amino Acids enter ribosome tRNA is complementary to mRNA Anticodon: complementary codon on tRNA mRNA codon: ACC tRNA anti-codon: mRNA codon: GUC tRNA anticodon: Each tRNA is specific for 1 Amino Acid

Elongation After start codon, tRNA with the anticodon matching the next mRNA codon enters A site Methionine and new Amino Acid form a peptide bond tRNA carrying Met enters E site, new tRNA enters P site Original tRNA leaves, new tRNA enters A site This continues, adding Amino Acids to a growing polypeptide chain Amino Acids Arrive at A site Amino Acids bond at P site Amino Acids Exit at E site

Termination Elongation continues until a stop codon is reached Stop codon does not have a matching tRNA Polypeptide chain ends, ribosome, mRNA and polypeptide chain split

Translation

Translation

Translation Mechanism MET This process continues until a stop codon is reached, at which point the mRNA strand, tRNA units, and rRNA subunits are all released. MET ISO PRO A U G C tRNA U A U tRNA U A C tRNA U A C tRNA U A U tRNA G G G Start Codon (Methionine) Large Ribosomal Subunit (rRNA) E Site A Site P Site mRNA A U G C Small Ribosomal Subunit (rRNA)

Translation

Process: A U G G U C C G A U C A G ribosome mRNA tRNA A. A. A. A. Codon: 3 nucleotides of mRNA AntiCodon: 3 nucleotides of tRNA U G C G A. A. A U C A. A. G A A. A. Amino Acid tRNA

Number the 4 anti- codons in the order they occur TRANSLATION Process of assembling polypeptides from information encoded in mRNA; Interpreting the code! Number the 4 anti- codons in the order they occur

Only 20 Amino Acids 1 START codon 3 STOP codons 12/1/2018 5:00 PM © 2007 Microsoft Corporation. All rights reserved. Microsoft, Windows, Windows Vista and other product names are or may be registered trademarks and/or trademarks in the U.S. and/or other countries. The information herein is for informational purposes only and represents the current view of Microsoft Corporation as of the date of this presentation. Because Microsoft must respond to changing market conditions, it should not be interpreted to be a commitment on the part of Microsoft, and Microsoft cannot guarantee the accuracy of any information provided after the date of this presentation. MICROSOFT MAKES NO WARRANTIES, EXPRESS, IMPLIED OR STATUTORY, AS TO THE INFORMATION IN THIS PRESENTATION.

1. Which two mRNA codes correspond to histidine? 2. How many different mRNA codes correspond to arginine?

Protein Synthesis Summary

Review What are the three parts to the Central Dogma? How is RNA similar to DNA? How is RNA different from DNA? What are the 3 types of RNA? Recall: How do amino acids differ from each other? What are the bonds that hold together the amino acids?

Mutations Mutations can happen in two locations: Sex cells: affect the offspring Body cells: affect the individual only Mutations can have one of three affects: Those that cause a disease Those that are beneficial Silent mutations: do not cause disease – most common Mutations can be one of two types: Point mutations: affecting single nucleotide Chromosomal mutations: affect section of or whole chromosome

Causes of Mutations Mistakes in base paring during DNA Replication DNA Polymerase can usually detect such errors When missed, may cause many genetic disorders Chemicals: like tobacco Can lead to cancer because it changes the genes that regulate mitosis Radiation: including UV (sun) and X-ray

Point Mutations 1. Substitution One nitrogen base is substituted for another Sickle Cell Anemia: substitute A for T

Point Mutations 2. Deletions and insertions When a nitrogen base is deleted or added Causes a Frame shift mutations- because it moves the codon up or down Changes the sequence of amino acids

Mutation Expression Silent: no change in original sequence of proteins. May occur from change in base that does not change codon, or to a codon that codes for the same Amino Acid Missense: change in one DNA base pair that results in the substitution of one amino acid for another Nonsense: change in on DNA base pair that results in premature stop codon Rather than coding for an Amino Acid, the stop codon ends the production of the polypeptide chain results in a shortened protein that may function improperly or not at all. Most ______________ outcome.