DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2. 3. Nitrogenous Base Base Pairs: A – T C – G

DNA Organization Chromatin organized: DNA Histones One Duplicated Chromosome

DNA Functions Heredity Replication Protein Synthesis

Human Chromosomes A Pair of Duplicated Chromosomes Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes they are the same - code for same type of trait they are different - code for different version of trait

Understanding the Numbers 1 chromosome is 1 large DNA molecule a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG 1000-2000 genes per chromosome 25,000-30,000 genes per human genome

Genetic Terminology Genes Alleles Locus Homozygous Heterozygous contain genetic information about a specific trait Alleles slightly different forms of genes on homologous chromosomes Locus the gene’s specific site on the chromosome Homozygous pair of the same alleles Heterozygous pair of different alleles Dominant allele whose trait is expressed represented by upper case letters "A" Recessive allele whose trait is masked by the dominant allele represented by lower case letters "a"

Genotypes and Phenotypes

Autosomal Recessive Inheritance PKU Cystic Fibrosis Tay-Sachs Disease

X-Linked Recessive Inheritance Hemophilia Duschenne’s Muscular Dystrophy Red/Green Color Blindness

Replication Making an exact copy of DNA Occurs just prior to cell division Double helix unwinds DNA polymerase adds bases Two exact copies are made

Protein Synthesis Transcription DNA to mRNA Translation mRNA to Protein

From Gene to Protein DNA RNA Protein

Genetic Code Codons three base code Code for specific amino acids

Point Mutation Spontaneous Mutation Environmental Insult Mutagenesis Carcinogenesis Mutation is corrected

Point Mutation Mutation is not corrected Mutation is corrected

Sickle-Cell Anemia Mutation

Sickle-Cell Anemia Mutation

Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: one from mom one from dad If one is bad, this increases your chance of getting the disease

Cancer in Women

Lung Cancer

The Neuron

Nerves Bundles of Axons Same function Phrenic nerve Alcohol Overdose

Axonal Membrane of a Neuron

Ion Channels Cell membrane proteins that pass ions in and out of the cell Voltage-Gated Ion Channels gates are regulated by membrane voltage Chemical-Gated Ion Channels (also called Receptors) gates are regulated by neurotransmitters Iontotropic fast Metabotropic (G-protein coupled) requires second messenger cascade slow

Chemical-Gated Ion Channels Iontotropic Metabotropic

Electrochemical Gradient Inside the Cell More K+ Less Na+ Outside the Cell More Na+ Less K+ Ion Flow Mantra: Na+ In, K+ out

Depolarization/Hyperpolarization

Action Potential Phases 2 Rapid 3 1 Threshold 4 Phase Ion responsible Ion Channel Responsible 1. Threshold Na+ Chemical-gated Na+ channel 2. Rapid Depolarization Na+ Voltage-gated Na+ channel 3. Repolarization K+ Voltage -gated K+ channel 4. After Hyperpolarizatoin K+ Na+/K+ pumps

Na+/K+ Pumps After the Action Potential, Na+/K+ pumps move Na+ ions back out of the cell and move K+ ions back into the cell The movement is against the concentration gradient of each ion so it requires energy (ATP) The pumps move 3 Na+ ions for every 2 K+ ions

Unmyelinated Propagation

Myelinated Propagation

Synaptic Action Voltage-gated Ca2+ channels Synaptic Potentials: EPSP IPSP

Synaptic Potentials Excitatory Postsynaptic Potential (EPSP) triggered by excitatory neurotransmitters open ligand-gated Na+ channels allows Na+ to flow inside the cell causing a slight depolarization of the postsynaptic cell moves the postsynaptic cell closer to firing an action potential Inhibitory Postsynaptic Potential (IPSP) triggered by inhibitory neurotransmitters open ligand-gated K+ channels or Cl- channels allows K+ to flow out of the cell or Cl- to flow inside the cell causing a slight hyperpolarization of the postsynaptic cell moves the postsynaptic cell further from firing an action potential

Neurotransmitters Neuropeptides Amines Amino acids Opioid peptides Enkephalins (ENK) Endorphins (END) Peptide Hormones Oxytocin (Oxy) Substance P Cholecystokinin (CCK) Vasopressin (ADH) Neuropeptide Y (NPY) Hypothalamic Releasing Hormones GnRH TRH CRH Amines Quaternary amines Acetylcholine (ACh) Monoamines Catelcholamines Epinephrine (EPI) Norepinephrine (NE) Dopamine (DA) Indoleamines Serotonin (5-HT) Melatonin Amino acids Gamma-aminobutyric acid (GABA) Glutamate (GLU) Glycine Histamine (HIST)

Brain Organization

Spinal Cord Anatomy Dorsal Ventral Dorsal Horn: Sensory information in Ventral Horn: Motor information out

Sensory Action

Spinal Cord Organization Posterior Columns or Dorsal Columns Proprioception: sense of body part location and movement Lateral corticospinal pain temperature crude touch deep pressure tickle itch Name of Tract describes the direction of action potentials

Spinothalamic Tract Carries sensation of pain, temperature, crude touch, pressure, tickle and itch to the Somatosensory Cortex

Brainstem Brainstem: arousal center (ARAS) sensory in pathway motor out pathway Midbrain Superior Colliculus Inferior Colliculus Pons REM sleep Medulla breathing center cardiac center

Cranial Nerves I. Olfactory II. Optic III. Oculomotor IV. Trochlear smell II. Optic vision III. Oculomotor eye movement IV. Trochlear V. Trigeminal face movement mastication VI. Abducens VII. Facial face/tongue movement VIII. Vestibulocochlear hearing/balance IX. Glossopharyngeal taste/swallowing X. Vagus parasympathetic NS XI. Accessory neck movement XII. Hypoglossal tongue movement swallowing Cranial Nerves

Ascending Reticular Activating System (ARAS) Arousal Center

Cerebellum Motor Coordination Fine tuning of: sensory systems emotions learning and memory Autism decreased cerebellum size

Thalamus and Hypothalamus relay station Hypothalamus regulation center

Nucleus Reticularis Thalami NRT: GABA cells Gatekeeper

Hypothalamic Nuclei hunger/thirst blood pressure/heart rate blood pressure/shivering stress satiety sex memory reproduction thermoregulation reproduction circadian rhythms

Limbic System Emotion Rewards Memory smell aggression fear learning recognition memory smell recognition? memory

Basal Ganglia Movement Parkinson’s Disease cell death in substantia nigra

Cortical Lobes Frontal: Strategy and Planning Motor area Parietal: Somatosensory area Temporal: Audition, Language Occipital: Vision

Broadmann’s Cortical Reigions 1, 2, 3: Primary Somatosensory Area 4: Primary Motor Area 11: Odor Identification Area 17: Primary Visual Area 18: Secondary Visual Area 22: Wernike’s Area: Auditory Association Area – interprets the meaning of speech by translating words into thoughts 41, 42: Primary Auditory Area 43: Primary Gustatory Area 44: Broca’s Area: Motor Speech Area – produces speech