Do Now How do you think proteins are made in our bodies?! Write down a step by step process!

DNA Transcription and Translation Sections 12.3 and 12.4

Gene DNA RNA Protein Segment of DNA that codes for a protein The Central Dogma of Biology: DNA codes for RNA and RNA makes protein (the synthesis of) DNA RNA Protein

Beadle and Tatum Experiment Experiments on mold, Neurospora, were the first to demonstrate the relationship between genes and enzymes. Studied mold spores that were mutated by exposure to X-rays and grown on a complete medium Minimal Medium- no amino acids provided Complete Medium- all amino acids provided. (normally Neurospora can grow on both)

Beadle and Tatum Continued Grew spores exposed to X-rays on minimal medium. When there was no growth, the mutant was tested to see what amino acid it lacked. When the mutant grew on the minimal medium with arginine (amino acid), the mutant was missing the enzyme needed to make arginine.

One Gene-One Enzyme Beadle and Tatum’s Hypothesis: One gene codes for one polypeptide. polypeptide - a chain of covalently bonded amino acids. (proteins are made of one or more polypeptide)

Let’s make some observations about RNA’s structure

RNA RNA stands for: RNA is found: Ribonucleic acid Nucleus and Cytoplasm

RNA Structure Like DNA, RNA is made up of subunits called _____________, which are made of three parts: Sugar (ribose) Phosphate Nitrogen Base

RNA’s Nitrogen Bases Adenine (A) Cytosine (C) Guanine (G) Uracil (U)

There are 3 types of RNA: Messenger RNA (mRNA) – long strands of RNA nucleotides that are formed complementary to one strand of DNA. Carries genetic information from DNA in the nucleus to Ribosome in the cytoplasm.

Types of RNA: 2. Ribosomal RNA (rRNA) – associates with protein to form the ribosome.

Types of RNA: 3. Transfer RNA (tRNA) – smaller segments of RNA nucleotides that transport amino acids to the ribosomes.

All RNA is … Single stranded Many different shapes “Cheap copy” of DNA

Fill in chart below: DNA RNA Structure Sugar Base Example strand: Complimentary:

Do Now Fill in the Venn Diagram below: What are the three types of RNA? What is the purpose of each? What is the Central Dogma of Biology? DNA RNA Both

Transcription DNA mRNA First step in making proteins Process of taking one gene (DNA) and converting into a mRNA strand Location: Nucleus of the cell DNA mRNA

Steps to Transcription 1. An enzyme (RNA polymerase) attaches to the promoter (start signal region) of a gene and unwinds the DNA

Steps to Transcription (Cont.) 2. One strand acts as a template.

Steps to Transcription (Cont.) 3. A mRNA copy is made from the DNA template strand by RNA polymerase 4. mRNA is made until it reaches the termination (stop signal) sequence 5. mRNA is released, and the two strands of DNA rejoin.

Template vs. Non Template Strand

Transcribe this DNA to mRNA

Do Now Please grab the worksheet off my desk, and being working on it!

Transcription animation https://www.youtube.com/watch?v=gG7uCskUOrA

Do Now 5’ T A C C G G T A C A G T G 3’ 3’ A T G G C C A T G T C A C 5’ What is the purpose of transcription? Where does it start? (Where does it end?) What enzyme is involved? (review the process) Perform transcription below: 5’ T A C C G G T A C A G T G 3’ 3’ A T G G C C A T G T C A C 5’

Label the Transcription diagram Template Strand Non-Template Strand RNA Nucleotides mRNA RNA Polymerase

Do Now 3’ G A T T A C G A C A G T G 5’ 5’ C T A A T G C T G T C A C 3’ Perform transcription below: 3’ G A T T A C G A C A G T G 5’ 5’ C T A A T G C T G T C A C 3’

mRNA Processing Pre-mRNA – the original sequence of RNA created during transcription mRNA reaches the ribosomes

RNA Processing In Eukaryotes only Introns- non-coded sections (a.k.a “Junk” DNA) Exons- codes for a protein Before RNA leaves the nucleus, introns are removed and exons are spliced together A 5’cap and poly A tail are added to ends of the sequence mRNA leaves the nucleus through the nuclear pores

Why is it necessary to add the poly A tail and 5’ cap? Poly A Tail: Keeps mRNA from degradation 5’ Cap: helps mRNA bind to ribosome.

RNA Processing

Let’s try this example… Original DNA Sequence (DNA): 3’ GTACTACATGCTATGCAT 5’ Transcribe it (RNA): 5’ CAUGAUGUACGAUACGUA 3’ Add the 5’ cap: 5’ CAUGAUGUACGAUACGUA 3’ cap

Finish the job! Add a poly A tail onto the 3’ end Remove the introns “UGUA” and “AUAC”: 5’ CAUGAUGUACGAUACGUA 3’ cap 5’ CAUGACGGUA 3’ cap Add a poly A tail onto the 3’ end 5’ CAUGACGGUA 3’ cap Poly A tail

Think, Pair, Share Take a minute think on your own, then pair with your partner, and share your ideas! Evolutionary, why do you think there are introns? Where did they come from? Remember there is NO wrong answer!

Do Now Perform transcription on this DNA segment: 3’G C T T C A T A C G A 5’ Do RNA processing and remove the introns: GAA and UGC

Do Now-PD. 8 Perform transcription on this DNA segment: 5’ C T A A T G C T G T C T G 3’ Do RNA processing and remove the introns: CUG and AUG

Proteins are made up of amino acids!!! Proteins are polymers of amino acids Only 20 different amino acids BUT there are hundreds of thousands of different proteins How can this be?

Proteins- (PCFNa) -made of 20 different Amino Acids - Amino Acids bond to form polypeptide chains

How do amino acids form these peptide chains? Peptide Bonds – Link each amino acids together to form proteins created by dehydration synthesis!

How many water molecules are formed from 2 amino acids?

Pg. 339 Pg. 339

Protein Structure http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm

Do Now Welcome back! Hope you had a wonderful break!  Please grab the worksheet off my desk, and begin working on it. It should be just a review of the things we discussed before break. Notes are not needed.

Translation Production of proteins from mRNA mRNA goes to the ribosomes in the cytoplasm or the RoughER and produces proteins Three main stages: Initation Elongation Termination

Ribosome Two subunits to the ribosome Large subunit, and small subunit 3 sites (grooves) on the ribosome (A, P, E ) A: tRNA binding site P: polypeptite bonding site E: exit site

Steps to Translation Initiation: 1. mRNA leaves the nucleus and binds to a ribosome 2. The two ribosomal subunits come together at the 5’ end of the mRNA. 3. Ribosome will find the start Codon (AUG) and the first tRNA molecule will attach This is the only tRNA that will attach to the P site (and skip the A site) The first amino acid is always methionine. Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons)

tRNA tRNA has an anticodon that matches the codon on the mRNA strand Anticodon: Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)

Steps to Translation (Cont.) Elongation: 4. Amino acids attached to a tRNA molecules are brought over to the mRNA, and load in at the A site of the ribosome. 5. A polypeptide bond is formed between the amino acids in the P and A sites of ribosome. 6. Ribosome shifts over, opening up the A site for a new tRNA molecule. 7. tRNA in the E site leaves, leaving behind the amino acid.

Steps to Translation (Cont.) Termination: 8.Translation is terminated when a stop codon is reached. There are three different stop codons UGA, UAA, UAG. 9. The release factor recognizes the stop codon, attaches to the mRNA strand in the A site of ribosome, and releases the polypeptide strand. All the factors break apart and can be reused again.

Translation Animations http://www.stolaf.edu/people/giannini/flashanim at/molgenetics/translation.swf https://www.youtube.com/watch?v=itsb2SqR- R0&nohtml5=False https://www.youtube.com/watch?v=JTc18Yh7bSU

Do Now How does translation start? What groove site does the first tRNA molecule sit? What occurs between the A and P site of the ribosome? How does translation know when it ends? How does it end?

Think-Pair-Share The mRNA sequence reads the following codons: What amino acids do they stand for? AUG GGA GAG CAA ** What amino acid does the anticodon CGU stand for?***

Think – Pair - Share Find the amino acid sequence for the following mRNA sequence (translation) AUGCGACGAAUUUAA

Think – Pair - Share Find the amino acid sequence tRNA: UACUUUAGUGGGCAUAUU

Do Now Conduct transcription and translation( remember start and stop codons!) DNA: 3’ TTTTATACTGAGGGTTAACTCGT 5’ mRNA: AA:

Do Now Pd. 1 Find the protein sequence from this molecule: tRNA: UAGACUUACUUCAGUGCGCAUAGU

Mistakes in DNA Cell make mistakes in replication, and transcription Most often these mistakes are fixed When these mistakes aren’t fixed, it causes a mutation. A permanent change that occurs in a cell’s DNA is called a mutation.

Point Mutation Substitution: A change in just one base pair Missense Mutation: amino acid is change Nonsense Mutation: amino acid is changed to a stop codon Cause translation to terminate early. Usually leads to proteins that can’t function normally. Silent Mutation: change codes for same amino acid and cause no change in protein produced.

Frameshift Mutations Causes the reading frame to shift to the left or the right Insertion: Addition of a nucleotide Deletion: Removal of a nucleotide

ACGAAATACAGACATATT Decide what type of mutation occurred: ACGAAATACATACATATT ACGAAATACAGAATATT ACGAAATACAGGACATATT ACGAAATACAGTCATATT

Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or radiation that can cause DNA damage Causes bases to mispair and bond with the wrong base High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic.

Sex Cell vs. Somatic Cell Mutations Somatic cell mutations are not passed on to the next generation. Mutations that occur in sex cells (gamete cells) are passed on to the organism’s offspring and will be present in every cell of the offspring

Chromosomal Mutations Inversion: Piece of chromosome can be broken off, duplicated, or moved to another chromosome

Fragile X Syndrome Repeat of CGG about 30 times Causes mental and behavior impairments

Protein Folding and Stability Substitutions also can lead to genetic disorders. Ex. Sickle Cell Anemia (caused by a substitution mutation) Can change both the folding and stability of the protein

Sickle Cell Anemia

Mutation Videos!! https://www.youtube.com/watch?v=GieZ3pk9YVo https://www.youtube.com/watch?v=dv486goSIzk https://www.youtube.com/watch?v=qWgCnsvx2h0