Do Now: Answer the following questions: Why is DNA important Do Now: Answer the following questions: Why is DNA important? What is a section of DNA called? Where do we find DNA? Why does DNA need RNA?

What is the Genome Project? In 1990, the United States began the Human Genome Project The purpose of this project was to: identify all the approximately 20,000-25,000 genes in human DNA determine the sequences of the 3 billion chemical base pairs that make up human DNA to store this information in databases The project was completed in 2003 (13 years later)

Why was the Genome Project important? The genome project allowed scientist to identify mutated genes in a person’s DNA. This information can be used to identify a person risk of developing a disease like cancer or diabetes. In the future, it may be possible to fix these mutations with gene therapy.

What are some negative effects of the Genome Project? Health Insurance companies may abuse the information collected in the Genome Project. Insurance companies may charge more money to those people who have a gene for a costly disease even though they do not have the disease yet. Insurance companies may deny insurance to any person who they feel may be at risk Employers may use this information not to hire someone because the person may be at risk of developing a disease.

AIM: Now that we know a lot about DNA what can we do with this information? http://www.youtube.com/watch?v=2k5sn15tERo http://www.youtube.com/watch?v=Exz0yNdvksg http://www.youtube.com/watch?v=Vz4ov8ia-8Y&feature=fvst

How can DNA be used in paternity tests and solving crimes? All living things have cells. All cells have nuclei (except red blood cells). All nuclei have DNA in them. Although we all have DNA, everyone's DNA is slightly different. (by less than 1%) If a cell is found at a crime scene or is used in a paternity test, the DNA can be extracted (taken out) and analyzed for a DNA “fingerprint” or uniqueness.

Are these the same? 1 Engage: This phase of the 5 E's starts the process. An "engage" activity should do the following: Make connections between past and present learning experiences Anticipate activities and focus students' thinking on the learning outcomes of current activities. Students should become mentally engaged in the concept, process, or skill to be learned.

Are these the same? 1 Engage: This phase of the 5 E's starts the process. An "engage" activity should do the following: Make connections between past and present learning experiences Anticipate activities and focus students' thinking on the learning outcomes of current activities. Students should become mentally engaged in the concept, process, or skill to be learned.

Are these the same? AATTGAATTCGCCGTAGATGCGCTGAGTTCGGCTGGAGTGTGGATTCGGSTTAGGTTTATTGGGTCACACGAATTCGACGATTCTTGATACGCTGGACGTGACGATACAGTAGACAGATTTGAATTCGCCGGTCTTAAATGCTGACGGC AATTGAATTCGCCGGAATTCCGCTGAGTTCGGCTGGAGTGTGGATTCGGSTTAGAATTCTTGGGTCACACATGGTGACGATTCTTGATACGCTGGACGTGACGATACAGTAGACAGATTTGAATTCGCCGGGAATTCATGCTGACGGC 1 Engage: This phase of the 5 E's starts the process. An "engage" activity should do the following: Make connections between past and present learning experiences Anticipate activities and focus students' thinking on the learning outcomes of current activities. Students should become mentally engaged in the concept, process, or skill to be learned. 2 Explore: This phase of the 5 E's provides students with a common base of experiences. They identify and develop concepts, processes, and skills. During this phase, students actively explore their environment or manipulate materials.

Are these the same? AATTG AATTCGCCGTAGATGCGCTGAGTTCGGCTGGAGTGTGGATTCGGSTTAGGTTTATTGGGTCACACG AATTCGACGATTCTTGATACGCTGGACGTGACGATACAGTAGACAGATTTG AATTCGCCGGTCTTAAATGCTGACGGC AATTCGCCGG AATTCCGCTGAGTTCGGCTGGA GTGTGGATTCGGSTTAG AATTCTTGGGTCACACATGGTGACGATTCTTGATACGCTGGACGTGACGATACAGTAGACAGATTTG AATTCGCCGGG AATTCATGCTGACGGC 1 Engage: This phase of the 5 E's starts the process. An "engage" activity should do the following: Make connections between past and present learning experiences Anticipate activities and focus students' thinking on the learning outcomes of current activities. Students should become mentally engaged in the concept, process, or skill to be learned. 2 Explore: This phase of the 5 E's provides students with a common base of experiences. They identify and develop concepts, processes, and skills. During this phase, students actively explore their environment or manipulate materials.

Are these the same? AATTGAATTCGCCGTAGATGCGCTGAGTTCGGCTGGAGTGTGGATTCGGSTTAGGTTTATTGGGTCACACGAATTCGACGATTCTTGATACGCTGGACGTGACGATACAGTAGACAGATTTGAATTCGCCGGTCTTAAATGCTGACGGC AATTGAATTCGCCGGAATTCCGCTGAGTTCGGCTGGAGTGTGGATTCGGSTTAGAATTCTTGGGTCACACATGGTGACGATTCTTGATACGCTGGACGTGACGATACAGTAGACAGATTTGAATTCGCCGGGAATTCATGCTGACGGC 1 Engage: This phase of the 5 E's starts the process. An "engage" activity should do the following: Make connections between past and present learning experiences Anticipate activities and focus students' thinking on the learning outcomes of current activities. Students should become mentally engaged in the concept, process, or skill to be learned. 2 Explore: This phase of the 5 E's provides students with a common base of experiences. They identify and develop concepts, processes, and skills. During this phase, students actively explore their environment or manipulate materials.

Gel Electrophoresis Gel electrophoresis is a technique where a scientist removes the DNA from the cell. Then, they cut the DNA at specific places with restriction enzymes. These cuts results in different sizes piece of the DNA (fragments). The tiny pieces of DNA are put into a tray filled with gel and the scientist applies an electrical current to the gel. ___________________________

The current attracts or “pulls” the fragments of DNA through the gel. The gel is made up with a lot of tiny holes. The smaller pieces travel through the gel the farthest because they have an easier time moving through the holes of the gel. The bigger pieces barely move at all because they have a harder time getting through the holes. Because of the different rates that each size piece moves, the DNA pieces form “bands” in the gel. Scientists compare these bands to bands from another person’s DNA or to DNA left at the scene and look for matching bands. The more bands that match, the more similar the DNAs are.

Paternity Testing Using gel electrophoresis (“the DNA test”) is key in determining the parents of a child. It is important to remember that the child’s DNA came from both of the parents…50% from mom; 50% from dad…and the DNA fingerprint should reflect this.

Using Electrophoresis in Evolution Electrophoresis can also be used to determine ancestries of different organisms. By comparing the matching bands between different organisms, scientist can determine how close organisms are related. Example – A Chimpanzee's DNA matches a human about 98%, while a dog only matches about 75%. This means the humans are more closely related to chimpanzees than dogs.

Adam Bruno Charles