Abstract Among the six known functional human beta-tubulin genes, the TUBB gene is widely expressed and thought to encode the major tubulin in epithelial.

Slides:



Advertisements
Similar presentations
Detection of the human Mitochondrial DNA A Polymerase Chain Reaction Experiment.
Advertisements

 -GLOBIN MUTATIONS AND SICKLE CELL DISORDER (SCD) - RESTRICTION FRAGMENT LENGTH POLYMORPHISMS (RFLP)
DNA fingerprinting Every human carries a unique set of genes (except twins!) The order of the base pairs in the sequence of every human varies In a single.
ATG GAG GAA GAA GAT GAA GAG ATC TTA TCG TCT TCC GAT TGC GAC GAT TCC AGC GAT AGT TAC AAG GAT GAT TCT CAA GAT TCT GAA GGA GAA AAC GAT AAC CCT GAG TGC GAA.
Supplementary Fig.1: oligonucleotide primer sequences.
SNP Genotyping Without Probes by High Resolution Melting of Small Amplicons Robert Pryor 1, Michael Liew 2 Robert Palais 3, and Carl Wittwer 1, 2 1 Dept.
Genomic DNA purification
Figure S1. Sequence alignment of yeast and horse cyt-c (Identity~60%), green highly conserved residues. There are 40 amino acid differences in the primary.
Mutation  Is a change in the genetic material.  Structural change in genomic DNA which can be transmitted from cell to it is daughter cell.  Structural.
GENE MUTATIONS aka point mutations. DNA sequence ↓ mRNA sequence ↓ Polypeptide Gene mutations which affect only one gene Transcription Translation © 2010.
Fine Structure and Analysis of Eukaryotic Genes
Nature and Action of the Gene
Biological Dynamics Group Central Dogma: DNA->RNA->Protein.
Expression of the Genome The transcriptome. Decoding the Genetic Information  The information is encoded in nucleotide sequences contained in discrete.
More on translation. How DNA codes proteins The primary structure of each protein (the sequence of amino acids in the polypeptide chains that make up.
Polymerase Chain Reaction (PCR) What is PCR?: Use of DNA polymerase to selectively amplify a segment of DNA from a much larger sample. Xeroxing DNA, start.
Linkage Mapping of the Angiotensin I Converting Enzyme Gene in Pig V.Q. Nguyen 1, K.L. Glenn 2, B.E. Mote 2, and M.F. Rothschild 2 1 Department of Biological.
Expression of the Genome The transcriptome. Decoding the Genetic Information  Information encoded in nucleotide sequences contained in discrete units.
Lecture 10, CS5671 Neural Network Applications Problems Input transformation Network Architectures Assessing Performance.
Human Genomics. Writing in RED indicates the SQA outcomes. Writing in BLACK explains these outcomes in depth.
The polymerase chain reaction
Amplification of a DNA fragment by Polymerase Chain Reaction (PCR) Ms. Nadia Amara.
Lesson Four Structure of a Gene. Gene Structure What is a gene? Gene: a unit of DNA on a chromosome that codes for a protein(s) –Exons –Introns –Promoter.
Development of Tetra-Primer ARMS-PCR for Hemoglobin E Detection
Human Genomics Higher Human Biology. Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA.
PCR mediated mutagenesis 2013 년도 2 학기 생화학 실험 (2) 5 주차 조교 : 안성원.
이희두. Polymerase Chain Reaction  Technique widely used in molecular biology  With PCR it is possible to amplify a single or few copies of DNA across.
Research Techniques Made Simple: Polymerase Chain Reaction
Introduction to PCR Polymerase Chain Reaction
Polymerase Chain Reaction
Lesson Four Structure of a Gene.
Xiang Qian, Long Jin, Elzbieta Kulig, Ricardo V. Lloyd 
Lesson Four Structure of a Gene.
Modelling Proteomes.
Why are proteins absolutely awesome?
Expression of the Genome
Molecular study of two types of mutations in promoters of IL-2 and IL-10 genes in Iraqi patients with Tuberculosis Mazin S.Salman Awatif.
GENE MUTATIONS aka point mutations © 2016 Paul Billiet ODWS.
Polymerase Chain Reaction
Expression of the Genome
Tissue-Specific Reduction in Splicing Efficiency of IKBKAP Due to the Major Mutation Associated with Familial Dysautonomia  Math P. Cuajungco, Maire Leyne,
by Nancy D. Borson, Martha Q. Lacy, and Peter J. Wettstein
Schematic of Eukaryotic Protein-Coding Locus
Outline What is an amino acid / protein
More on translation.
Leukemic Cellular Retinoic Acid Resistance and Missense Mutations in the PML-RAR Fusion Gene After Relapse of Acute Promyelocytic Leukemia From Treatment.
Methods used to study mutations
Quiz#8 LC710 10/20/10 name___________
A Missense Mutation (R565W) in Cirhin (FLJ14728) in North American Indian Childhood Cirrhosis  Pierre Chagnon, Jacques Michaud, Grant Mitchell, Jocelyne.
Fundamentals of Protein Structure
A Clinical Grade Sequencing-Based Assay for CEBPA Mutation Testing
Mutations are changes in the genetic material of a cell or virus
Serotonin Transporter Promoter Gain-of-Function Genotypes Are Linked to Obsessive- Compulsive Disorder  Xian-Zhang Hu, Robert H. Lipsky, Guanshan Zhu,
“TaqMan genotyping Assay’’
Volume 3, Issue 4, Pages (April 2013)
Rare Missense and Synonymous Variants in UBE1 Are Associated with X-Linked Infantile Spinal Muscular Atrophy  Juliane Ramser, Mary Ellen Ahearn, Claus.
Sequences and their Properties
Expression of the Genome
Martin J. Somerville, Kathleen A. Sprysak, Mark Hicks, Basil G
RAD51 is essential for L. donovani.
Gene Protein Genome Proteome Genomics Proteomics.
Human Elastase 1: Evidence for Expression in the Skin and the Identification of a Frequent Frameshift Polymorphism  Ulvi Talas, John Dunlop, Sahera Khalaf,
The polymerase chain reaction
Bruce L. Zuraw, MD, Jack Herschbach, BA 
Mutation of the Ca2+ Channel β Subunit Gene Cchb4 Is Associated with Ataxia and Seizures in the Lethargic (lh) Mouse  Daniel L Burgess, Julie M Jones,
Introduction to Bioinformatics II
Research Techniques Made Simple: Polymerase Chain Reaction
Shailaja Gantla, Conny T. M. Bakker, Bishram Deocharan, Narsing R
Figure Genetic characterization of the novel GYG1 gene mutation (A) GYG1_cDNA sequence and position of primers used. Genetic characterization of the novel.
Presentation transcript:

Abstract Among the six known functional human beta-tubulin genes, the TUBB gene is widely expressed and thought to encode the major tubulin in epithelial tumor cells with which taxanes interact. Mutation of TUBB has been reported in Chinese hamster ovary cells and an ovarian tumor cell line adapted for growth in the presence of paclitaxel. In NSCLC, Monzó et al. have reported TUBB mutation in 16 of 49 (33%) tumor samples from untreated patients and found a striking association between the presence of mutation and both poor treatment response to paclitaxel and shortened overall survival (JCO 17:1786). Based on this observation, the presence of beta-tubulin mutation has been proposed as the basis for chemotherapeutic drug selection in the management of patients with advanced NSCLC. To better study the association of TUBB mutation with tumor cell growth and taxane resistance, we analyzed TUBB in 25 NSCLC cell lines. PCR amplification of the four coding exons of TUBB from genomic DNA was accomplished by selecting oligonucleotide primers for PCR such that at least one oligonucleotide was complementary to intronic sequence. This requirement avoids co-amplification of the several tubulin processed pseudogenes that have high sequence identity within the coding region but are devoid of introns. Purified PCR products were sequenced on one strand for exons 1, 2, and 3 (57, 109, and 101 bases, respectively) and on both strands for exon 4 (1068 bases). Only two sequence variants were identified in the coding region and adjacent splice sites. Both were heterozygous single nucleotide variants in the third position of codons 187 and 217 that did not change the predicted amino acid. Each variant was present in one cell line and likely represents a polymorphism. Thus, mutation of TUBB is not common in NSCLC cell lines. Analysis of tumor samples is ongoing, however, the presence of TUBB mutation in tumor samples but not cell lines would be unusual in NSCLC where the frequency of genetic alterations of other genes is generally greater in cell lines than tumor samples. Alternatively, the previously reported TUBB mutations in NSCLC may be an artifact of co-amplificaiton of pseudogenes.

Introduction (1) Tubulin, the cellular target for taxanes, is composed of ab heterodimers. There are at least 6 genes encoding beta subunits of tubulin.1 In most epithelial tumor cells, TUBB is the most highly expressed isoform. Chinese hamster ovary cells and an ovarian tumor cell line adapted for growth in vitro in the presence of paclitaxel have been found to have mutations of TUBB4,5

Introduction (2) Monzó et al.2 have reported TUBB mutation in 16 of 49 (33%) tumor samples from untreated patients with NSCLC (all but two in exon 4). They also found a significant association between the presence of mutation and both poor treatment response to paclitaxel and shortened overall survival.2 Presence of TUBB mutation has been proposed as a basis for selecting initial chemotherapy for patients with advanced NSCLC

Methods (1) NSCLC cell lines Twenty-five NSCLC tumor cell lines were selected for tubulin gene analysis on the basis of available in vitro taxane drug sensitivity. Genomic DNA was isolated from these cell lines by proteinase K digestion and phenol/chloroform extraction.

Methods (2) Oligonucleotides for PCR Oligonucleotides were designed based on genomic sequence from the TUBB region from the Human Genome Project (GenBank accession number AC006165) using GeneWorks version 2.45 and requiring at least one oligonucleotide to be within intronic sequence.3

Methods (3) 1F CCCATACATACCTTGAGGCG 1R TTTGGACCGTTAGAAGCCC (sequencing oligo) 2F2 GAAGCAGAGGTTGCAGTGAG 2R2 TGACAGATTCACCCAAAGGG 2F AGAGCGAGACTCCGTCTCAA (sequencing oligo) 3F TCCCTTCTGCCAGATTTCAC 3R2 CAGGACAGAATCAACCAGCTC 3R CCCCTACTGCCCCATAATTT (sequencing oligo) 4F3 AGGTAGTGCCTACTATTGCTGG 4R4 TGAGTAAGACGGCTAAGGGAAC (sequencing oligo) 4R2 AGCCATCATGTTCTTGGCA (sequencing oligo) 4F2 AGTTGGCAGTCAACATGGTC (sequencing oligo) 4F4 TTGAGCTTTTCTCCTGACTGC (sequencing oligo) TP4F AGAGAGCTGTGACTGCCTG (from Monzó, 1999) TP4R AAGGTATTCATGATGCGA STP4 TCAGGGTATTCTTCTCGGAT (sequencing oligo)

Methods (4) TUBB amplification and sequencing3 PCR was performed in 10 mL reaction volume containing 1X PCR buffer, 1.5 mM MgCl2, 5 units Taq platinum, 0.2 mM each dNTP, and 0.2 mM each oligonucleotide primer. Typical cycling conditions were initial denaturation of 94C for 2 min followed by 30-40 cycles of 94C for 30 sec, annealing temperature for 30 sec, and 72C for 2 min and final extension time of 10 min at 72°C. PCR products were purified using QIAquick Spin PCR Purification Columns per manufacturer’s recommendations. DNA was sequenced using BigDye terminator kit.

Results (1) Summary of sequencing of TUBB gene exons 1 to 4 in 25 NSCLC cell lines Cell lines with variants Wild type cell lines (amino acid change) H23 H1385 H1930 H1648 (L187L*) H322 H1437 H1944 H2228 (L217L*) H522 H1466 H2023 A549 H1650 H2122 H676 H1755 H2286 * both silent changes H835 H1975 H2342 H1264 H1793 H2409 H1373 H1869

Results (2) Sequence variant in cell line H2228 using intron primers Sense Antisense

Results (3) Why do these results differ from those of Monzo? Comparison of sequence of PCR products using intronic primers with those using exonic primers

Results (4) Genomic Organization of TUBB Exon: 1 2 3 4 Oligos from this work: 4R2 4R4 4F3 4F4 4F2 Exon 4 intron 3 3’ UT TB4-F Oligos from Monzo: TP4-F TR4-F STR4 STB4 TB4-R (location unclear) TP4-R TR4-R STP4

Results (5) Location of 5’ PCR primer Intron Exon Codons 161-163 Sequence variants are observed when primers are located in Exon only

Results (6) Sequence variants found in the ribose-binding region of TUBB from tumor cell line DNA amplified with PCR primers located within exons. bp change codon codon change AA change type of change 474 A to A/G 158 GAA-GAG Glu-Glu silent 484 C to C/T 162 CGC-TGC Arg-Cys missense 487 A to A/T 163 ATC-TTC Ile-Phe missense 510 G to G/T 170 GTG-GTA Val-Val silent 518 C to C/A 173 CCC-CAC Pro-His missense 522 A to A/G 174 AAA-AAG Lys-Lys silent 538 G to G/A 180 GTC-ATC Val-Ile missense 540 C to C/T 180 GTC-GTT Val-Val silent 544 C to C/T 182 CCC-TCC Pro-Ser missense 555 C to C/T 185 GCC-GCT Ala-Ala silent 585 T to C 195 AAT-AAC Asn-Asn silent 603 C to C/T 201 TGC-TGT Cys-Cys silent 612 C to C/T 204 AAC-AAT Asn-Asn silent

TUBB Pseudogenes (1) A pseudogene is a sequence which is homologous to functional genes but which contains mutational changes precluding the formation of a functional product.6,7 Processed pseudogenes have structure similar to mRNA: no introns, no promoter, and with poly(A) tract.6,7 Genomic Organization of a TUBB pseudogene AATAAAN14(A)n 11-bp direct repeat

TUBB Pseudogenes (2) There are at least 8 pseudogenes for TUBB in the human genome (see alignment of ribose binding domain at right). At least some of these sequences are co-amplified when using primers within exons. Alignment of the ribose binding domain of exon 4 of TUBB with 8 sequences from the human genome that may be co-amplified with TUBB using exonic primers is shown at right.

Conclusions (1) Mutation of TUBB is uncommon in NSCLC. Prior reports of TUBB mutation in NSCLC may result from simultaneous amplification of TUBB, related tubulin genes, and processed pseudogenes.

Conclusions (2) TUBB mutation should not be used as a basis for selection of chemotherapy in NSCLC. The apparent association of sequence variants detected by TUBB sequence analysis with tumor response and survival in NSCLC remains unexplained.

References 1. Ludueña, RF Int Rev Cytolol 178:207, 1998. 2. Monzó, M et al. JCO 17:1786, 1999. 3. Owshalimpur D et al. Molec Probes, 1999. 4. Giannakakou, P, et al, JBC 272:17118, 1997. 5. Gonzalez-Garay, ML, JBC 274:23875, 1999. 6. Wilde, CD et al. Nature 297:83, 1982. 7. Gwo-Shu, M et al. Cell 33:477, 1983.