Deiminated REF in regulation of ATP synthase expression.

Slides:

Advertisements

Similar presentations

From: MicroRNA let-7 Regulates 3T3-L1 Adipogenesis

Advertisements

Marcello Arsura, Min Wu, Gail E Sonenshein Immunity

E2F7/8 and HIF1 are required for hypoxic VEGFA expression.

Loss of Hdac3 impairs Ar signaling in mouse prostate tissues and has no effect on apoptosis Loss of Hdac3 impairs Ar signaling in mouse prostate tissues.

BRD4 expression levels are associated with sensitivity to BET inhibition in NRAS‐mutant melanoma BRD4 expression levels are associated with sensitivity.

REF and ATP5b status on mitochondrial fraction.

SncRNA715 expression in oligodendrocytes.

Quercetin binding blocks PID kinase activity.

by Madhu Gupta, Paul T. Mungai, and Eugene Goldwasser

Downregulation of ΔNp73 leads to re‐activation of p53‐regulated genes and apoptosis. Downregulation of ΔNp73 leads to re‐activation of p53‐regulated genes.

Effects of iron chelation on mitochondrial function.

Cooperative formation of a higher‐order complex containing AP1 and HMG‐I(Y). Cooperative formation of a higher‐order complex containing AP1 and HMG‐I(Y).

Calcium regulates ERK nuclear association, but not its activation.

FOXP3 regulates cAMP production by regulating miR‐142‐3p and AC9.

Double‐stranded RNA binding of NS3 is required for HIV‐1 Tat complementation. Double‐stranded RNA binding of NS3 is required for HIV‐1 Tat complementation.

Tie1 silencing‐induced endothelial–mesenchymal transition is Slug dependent. Tie1 silencing‐induced endothelial–mesenchymal transition is Slug dependent.

CD74 induces TAp63 expression leading to B-cell survival

Mitophagy is independent of PINK1 and Parkin.

HDAC1 is an integral component of the Microprocessor complex and modifies its affinity to primary miRNA transcripts. HDAC1 is an integral component of.

SncRNA715 regulates MBP translation.

Inhibition of SERCA by cyclopiazonic acid normalises both the early decrease and late increase in cytosolic calcium and enhances the viability in differentiated.

Volume 69, Issue 4, Pages (February 2006)

Richard T. Ethridge, Mark R. Hellmich, Raymond N. DuBois, B.Mark Evers

NoRC regulates telomeric heterochromatin.

Mutations affecting HOIP–UBA and HOIL‐1L–UBL interaction that compromise NF‐κB activation. Mutations affecting HOIP–UBA and HOIL‐1L–UBL interaction that.

Mitochondrial targeting of ceramide induces lethal mitophagy in HPV(+) cells Mitochondrial targeting of ceramide induces lethal mitophagy in HPV(+) cells.

Volume 11, Issue 5, Pages (May 2007)

Volume 135, Issue 1, Pages (July 2008)

Volume 6, Issue 2, Pages (February 1997)

Volume 28, Issue 3, Pages (November 2007)

Lipopolysaccharide activation of the MEK-ERK1/2 pathway in human monocytic cells mediates tissue factor and tumor necrosis factor α expression by inducing.

Volume 135, Issue 5, Pages e3 (November 2008)

ECM29 mediates palbociclib‐induced proteasomal activation and may function as a putative biomarker for palbociclib treatment efficacy in breast cancer.

HPV‐E7 enhances chemotherapy‐mediated cellular stress and CerS1/ceramide‐mediated lethal mitophagy HPV‐E7 enhances chemotherapy‐mediated cellular stress.

MiR‐199a directly targets ERBB2 and ERBB3, whereas miR‐125b targets ERBB3. miR‐199a directly targets ERBB2 and ERBB3, whereas miR‐125b targets ERBB3. (A)

Lipids up-regulate uncoupling protein 2 expression in rat hepatocytes

Palbociclib activates the proteasome indirectly and reduces the association of ECM29 with the proteasome Palbociclib activates the proteasome indirectly.

Expression and regulation of Toll-like receptor 2 by IL-1β and fibronectin fragments in human articular chondrocytes S.-L. Su, M.S., C.-D. Tsai, Ph.D.,

HPV‐E7/RB axis regulates ceramide‐dependent mitophagy via E2F5 activation HPV‐E7/RB axis regulates ceramide‐dependent mitophagy via E2F5 activation AUM‐SCC‐47.

Rab22A localizes to the E/SE and REs and regulates RE dynamics

Mitochondrial ceramide is involved in HPV‐E7‐mediated lethal mitophagy

Figure 3. MAb 19H9 displays broad cross-reactivity with IAV strains of different subtypes. (A), Amino acid sequence ... Figure 3. MAb 19H9 displays broad.

The subcellular localization, dimerization with Arnt and DNA‐binding activity of AhR are altered by the activation of Gα13. The subcellular localization,

Histone deacetylase 1 protein depletion affects general histone acetylation and specific gene expression. Histone deacetylase 1 protein depletion affects.

HMGB1 reverses mitochondrial DNA damage caused by mutant Atxn1 The mitochondrial DNA amplification assay with cerebellar tissue revealed that mitochondrial.

Knockdown of DAO inhibits DNA damage–induced senescence.

Human ELAV protein HuR binds miRNA in Starved cells and is necessary for extracellular export of miRNA Human ELAV protein HuR binds miRNA in Starved cells.

The ERK pathway mediates the effect of EGF on LIMT, which normally inhibits mammary cell migration and invasion The ERK pathway mediates the effect of.

Volume 8, Issue 2, Pages (February 1998)

TGF‐β1 treatment induces the chromatin binding of Smad2/3/4 in 4T1 cells TGF‐β1 treatment induces the chromatin binding of Smad2/3/4 in 4T1 cells A, BWestern.

HDAC1 positively regulates the abundance of miRNAs.

HPV‐E7 targets RB for induction of ceramide‐dependent mitophagy

Pharmacological inhibition of DAO impairs DNA damage– and oncogene-induced senescence. Pharmacological inhibition of DAO impairs DNA damage– and oncogene-induced.

Acetylation status of critical lysine residues in dsRBD affects the binding of DGCR8 to primary miRNA transcripts. Acetylation status of critical lysine.

High proteasomal activity is involved in the palbociclib‐induced G1 arrest High proteasomal activity is involved in the palbociclib‐induced G1 arrest AMCF7.

Both E102Q and L95fs Sig1R variants are unstable and lose their abilities to control Ca2+ flux in Neuro2a cells Both E102Q and L95fs Sig1R variants are.

Klotho is a target gene of PPAR-γ

miR‐205 modulates tumor cell sensitivity to MET‐TKIs

Amanda O'Donnell, Shen-Hsi Yang, Andrew D. Sharrocks Molecular Cell

Marcello Arsura, Min Wu, Gail E Sonenshein Immunity

MiR‐499 is dynamically regulated during muscle fiber type transition and affects mitochondrial function miR‐499 is dynamically regulated during muscle.

1α,25-Dihydroxyvitamin D3 Stimulates Activator Protein 1 DNA-Binding Activity by a Phosphatidylinositol 3-Kinase/Ras/MEK/Extracellular Signal Regulated.

ADAM8 is induced by hypoxia and promotes angiogenesis ASixteen h after plating, cells were cultured under normoxic (−) or hypoxic (+, 1% O2) conditions.

Defective RAB1B-related megakaryocytic ER-to-Golgi transport in RUNX1 haplodeficiency: impact on von Willebrand factor by Gauthami Jalagadugula, Lawrence.

TNF Regulates the In Vivo Occupancy of Both Distal and Proximal Regulatory Regions of the MCP-1/JE Gene Dongsheng Ping, Peter L. Jones, Jeremy M. Boss

Expression of SENP2 mRNA is regulated by palmitate-induced NF-κB activation. Expression of SENP2 mRNA is regulated by palmitate-induced NF-κB activation.

miR-145 regulates IGF1R expression.

A, ATP production by PC3 prostate cancer cells after treatment with oligonucleotide/Lipofectin complexes. a, ATP production by PC3 prostate cancer cells.

Characterization of the complex formed at the Fra-1 RCE1.

Fig. 5 Dcr-2 directly binds to Toll 3′UTR.

Presentation transcript:

Deiminated REF in regulation of ATP synthase expression. Deiminated REF in regulation of ATP synthase expression. (A) Comparison of mean mitochondrial states 3 and 4 respiration rates between wild‐type (WT; CD1) and ND4 mice. (a) Respiration rates (states 3 and 4 as indicated) in synaptic (S) mitochondria isolated from ND4 (n=4) and CD1 (n=6) brains. (b) Respiration rates (states 3 and 4 as indicated) in non‐synaptic (NS) mitochondria isolated from ND4 (n=4) and CD1 (n=6) brains. Rate of oxygen consumption was measured in the presence and in the absence of ADP. (B) Comparison of mean mitochondrial ATP synthase activity between WT (CD1) and ND4 mice. Isolated mitochondria from brain non‐synaptic (NS, solid column) and synaptosomes (S, hollow column) were applied to ATP synthase measurement as indicated. (C) Electrophoretic mobility shift assay (EMSA) analysis of deiminated REF using an oligonucleotide probe 5′‐TGGGCAGAATCATGAATGTC‐3′. EMSA of non‐deiminated (d−) and deiminated (d+) REF as indicated in lane 2 and 3; the control lane was loaded only with probe. (D) Time course was generated by the ratio of bound and free probe (bound/free oligonucleotide) and incubation time and compared between non‐deiminated REF (d−; cross and dashed line) and deiminated REF (d+; square; solid line). Protein loading from an EMSA gel was probed for REF and its deimination status (lower panel) using antiREF and anticitrulline with secondary antimouse and antirabbit coupled with IR‐700 and IR‐800 scanned on an Odyssey infrared imaging system (Li‐Cor Biosciences, Lincoln, NE). (E) The mRNA expression after siRNA inhibition. Representative PAD2 and GAPDH protein as indicated were compared between the control and transfected cells. The expression level was quantified by ImageJ program (supplementary Fig S4D online). Control and PAD siRNA inhibited product were probed with antiREF and anticitrulline antibody, respectively (bottom panel). (F) The ATP synthase activity of PC12 cell line after PAD2 and PAD4 siRNA treatment. Control indicates the cells transfected with nonspecific negative siRNA, + siRNAs indicates the cells transfected with PAD2 and PAD4 siRNAs. All comparisons were made from at least three independent measurements with analysis of variance expressed as mean±s.d. All data were subjected to two‐tailed paired or unpaired t‐test with respect to controls (*), *P⩽0.05. ATP, adenosine triphosphate; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; REF, RNA binding export factor; siRNA, short interfering RNA. Di Ding et al. EMBO Rep. 2012;13:230-236 © as stated in the article, figure or figure legend