A mutation is a change in an organism’s DNA.

Slides:



Advertisements
Similar presentations
What do you think of when you hear the word “mutation”?
Advertisements

KEY CONCEPT Mutations are changes in DNA that may or may not affect observable traits/characteristics.
DNA replication—when? Where? Why? What else does a cell do?
SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.
Chapter 12-Inheritance Patterns and Human Genetics
Chapter 8 Section 8.7: Mutations.
Defined: a change in an organism’s DNA Where: DNA or Chromosomes When: During replication, Synapses, or Crossing-Over Mutations can affect a single.
A mutation is a change in an organism’s DNA.
Mutations are changes in DNA that may or may not affect phenotype.
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
Mutations Chapter 12.4.
Turn to your notes page after yesterday’s sheet! Read & do those questions… Quick, quick quick, 10 minutes! Happy Thursday!!! 10/27/2011.
Mutations Genetic Changes.
Mutations
MUTATIONS Honors Biology Section 11.6 & Biology Section 8.7 Revised 2011.
BIG PICTURE: MAKING PROTEINS DNA  RNA  PROTEIN Nucleus  Cytoplasm  Ribosomes.
8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.
MUTATIONS.
8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.
KEY CONCEPT 8.5 Translation converts an mRNA message into a polypeptide, or protein.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.
Reality Science Fiction! Just silly.. 1. Some mutations affect a single gene, while others affect an entire chromosome. 2. A mutation is a change in an.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)
Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.
Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.
MUTATIONS Mutations Defined: a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. 2 Types: 1)Gene Mutations:
8.7 Mutations A mutation is a change in an organism’s DNA. May occur during replication. May affect a single gene, or an entire chromosome May or may not.
8.2 KEY CONCEPT DNA structure is the same in all organisms.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.
Protein Synthesis The Making of Proteins Using Genetic Information.
Griffith finds a ‘transforming principle.’
May occur in somatic cells (aren‘t passed to offspring)
Mutations 6/26/2018 SB2d.
A mutation is a change in an organism’s DNA.
Mutations.
Mutations.
Mutations.
A mutation is a change in an organism’s DNA.
Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?
MUTATIONS.
UNIT 5 Protein Synthesis.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Mutations.
Some mutations affect a single gene, while others affect an entire chromosome.
mutation = change in an organism’s DNA.
A ____________ is a change in an organism’s DNA.
Sexual reproduction creates unique combinations of genes.
A mutation is a change in an organism’s DNA.
SB2. The learner will analyze how biological traits are passed on to successive generations. d. Describe the relationships between changes in DNA and potential.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Mutations Chapter 8.7.
SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
MUTATIONS.
DNA: The Blueprints For Life
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Mutations Chapter 8.7
Objective: Explain the main types of mutations
Copyright Pearson Prentice Hall
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
GENE MUTATIONS (in DNA)
A mutation is a change in an organism’s DNA
Presentation transcript:

KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

A mutation is a change in an organism’s DNA. Some mutations affect a single gene, while others affect an entire chromosome. A mutation is a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. A point mutation substitutes one nucleotide for another. mutated base

1. Point mutations: change in ONE DNA base ..called SUBSTITUTION GENE MUTATIONS: 1. Point mutations: change in ONE DNA base ..called SUBSTITUTION This would change the meaning of the codon on the mRNA Example: THE DOG BIT THE CAT THE DOG BIT THE CAR = mutation mutated base

GENE MUTATIONS 2. Frameshift mutations: a single base is added or deleted from DNA…called ADDITION OR DELETION This would cause every codon to be wrong from that point on in protein coding Example: THE CAT ATE THE FAT RAT THE ATA TET HEF ATR ATT = mutation

Chromosomal mutations affect many genes. Chromosomal mutations may occur during crossing over Chromosomal mutations affect many genes. Gene duplication results from unequal crossing over.

CHROMOSOMAL MUTATIONS: 1. Affects the ENTIRE chromosome -If a chromosome is missing= MONOSOMY = 45 chromosomes -May involve an extra chromosome =TRISOMY = 47 chromosomes 2. TRANSLOCATION results from the exchange of DNA segments between nonhomologous chromosomes or INVERSION flips a segment around

Chromosomal mutations tend to have a big effect. POTENTIAL IMPACT Chromosomal mutations tend to have a big effect. A mutation may cause a premature stop codon. A mutation may change protein shape or the active site. A mutation may change gene regulation. blockage no blockage

. SILENT MUTATIONS A mutation may occur in a noncoding region. A mutation may not affect protein folding or the active site.

Mutations in body cells do not affect offspring. Mutations in sex cells can be harmful or beneficial to offspring. Natural selection often removes mutant alleles from a population when they are less adaptive.

Mutations can be caused by several factors. Replication errors can cause mutations. Mutagens, such as UV ray and chemicals, can cause mutations. Some cancer drugs use mutagenic properties to kill cancer cells.