TRANSCRIPTION VERSUS TRANSLATION DNA VERSUS RNA TRANSCRIPTION VERSUS TRANSLATION

Michigan Benchmarks B4.2x DNA, RNA and Protein Synthesis B4.2g Describe the process of replication, transcription, and how they relate to each other in molecular biology.

Two Types of Nucleic Acids: DNA—Deoxyribonucleic Acid Set of directions for the cell RNA—Ribonucleic Acid Involved with protein synthesis

Proteins Review of proteins: Building blocks—amino acids (20) different types

Function of Proteins— Enzymes—speed up chemical reactions Structures—muscle, teeth, hair, skin, bones, organs Hormones—insulin, estrogen, testosterone

Type of protein The arrangement of hundreds of amino acids determines type of protein; The type of protein in a cell determines the kind of cell it is and its function.

RNA Structure— Ribonucleic acid Molecule that carries out the “instructions” coded in DNA DNA-original RNA-copy Composed of nucleotides—building blocks

Review/Explain: Types of Nucleic Acids What are the two types of nuclei acids? Ribonucleic Acid (RNA) – Single Stranded Deoxyribonucleic Acid (DNA) Double Helix (Twisted Ladder)

RNA Ribonucleic Acid (RNA) Sugar + Phosphate Backbone Differs from DNA Single Stranded Ribose Sugar Base Pairs A-U, G-C Are there T’s in RNA? A, U no T’s in RNA RNA assists DNA in manufacturing needed proteins

RNA Versus DNA: Different from DNA in 4 ways— So DNA= TAG Then RNA=AUC Sugar in RNA is ribose (DNA-Deoxyribose) Single-stranded (DNA—double stranded) Has uracil as a base instead of thymine So DNA= TAG Then RNA=AUC

Practice On your paper, complete the missing DNA strand by adding the complementary bases. A T C G T T G C C A T C T A G C A A C G G T A G Make the complementary RNA strand for the single strand of DNA below: A A T C A T C A C G T T U U A G U A G U G C A A

RNA occurs in 3 Different forms: 1.mRNA—messenger RNA (transcription); carries the “blue print” for a particular protein out of nucleus to a site on ribosome 2. tRNA—transfer RNA; attaches to amino acids and carries it to ribosomes (translation) 3. rRNA—ribosomal RNA --makes up part of the ribosome --believed to bond amino acids to form protein chain

--RNA polymerase—enzyme that binds to a region in DNA (promoter) – this unwinds the DNA double helix and seperates a section into two strands

Major players in transcription RNA polymerase- complex of enzymes with 2 functions: Unwind DNA sequence Produce primary transcript by stringing together the chain of RNA nucleotides

Major players in transcription mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

Transcription RNA forms base pairs with DNA C-G A-U Primary transcript- length of RNA that results from the process of transcription

TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGG ACU

Transcription Graphics

Only one side of the DNA double helix is transcribed, called the leading strand (the other side is the lagging strand)

Transcription Graphics

Reminder: DNA A-T; G-C RNA A-U; G-C Pairing begins with that sense strand to form RNA strand

DNA strand CGATG paired GCTAC *RNA strand GCUAC Bonding of the RNA strand together is next step. RNA nucleotide phosphate bonds to sugar (ribose) of another RNA nucleotide

Bonding continues until terminator on the DNA strand is met; Terminator- codes for the end of a protein Separation of RNA strand from DNA strand 

mRNA Processing Primary transcript is not mature mRNA DNA sequence has coding regions (exons) and non-coding regions (introns) Introns must be removed before primary transcript is mRNA and can leave nucleus

Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code?

How the Codes Work How the Code Works   In DNA—triplet codes for an amino acid; mRNA carries the code for amino acids in groups of 3 nucleotides 

Codons Codon—the nucleotide sequence in mRNA that codes for a specific amino acid Ex) GUC~forms amino acid valine Codons are like three letter words Note: several codons may code for same amino acids  

Initiation Codon—a codon that signals the beginning of a protein; AUG (Methionine) DNA genetic code is almost universal… a given codon codes for the same amino acid in different organisms (some exceptions include mitochondrial DNA)

The Genetic Code

Reading the DNA code Every 3 DNA bases pairs with 3 mRNA bases Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases

ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGG ACUG

Translation Second stage of protein production mRNA is on a ribosome

Translation Building proteins molecules by mRNA code Involves ribosomal RNA (rRNA) tRNA take free floating amino acids, not randomly Anticodon—determines which amino acids the tRNA will carry  

Translation Second stage of protein production mRNA is on a ribosome tRNA brings amino acids to the ribosome

Transcription vs. Translation Review Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA tRNA

RNA What is the Main Job of RNA? It retrieves the protein code from DNA and carry out the processes needed to produce proteins. What are the basic units or monomers of DNA? Nucleotides Where is RNA found? It is found both inside and outside of the nucleus.

DNA What is the Main Job of DNA? It contains the code for the proteins an organism may produce. What are the basic units or monomers of DNA? Nucleotides make up DNA. Where is DNA found? It is found mostly in the nucleus of a cell making up its chromosomes.