CISC 667 Intro to Bioinformatics (Fall 2005) Molecular Biology A Primer What is Life Three kingdoms The Cell thoery Central Dogma Genetic code Transcription Translation CISC667, F05, Lec2, Liao

Organisms: three kindoms of life -- eukaryotes, eubacteria, and archea Observation: a lot of living things Why does Mother nature have this biodiversity? Answers Simple classification based on morphological features Theory: evolution – mutations, natural selection, … Tree of life NCBI Taxonomy http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Taxonomy Cell: the basic unit of life Every living thing is made of cells. Every cell comes from a pre-existing cell. CISC667, F05, Lec2, Liao

10-9 10-6 10-3 CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

> circular, also called plasmid when small (for bacteria) Chromosome (DNA) > circular, also called plasmid when small (for bacteria) > linear (for eukaryotes) Genes: segments on DNA that contain the instructions for organism's structure and function Proteins: the workhorse for the cell. > establishment and maintenance of structure > transport. e.g., hemoglobin, and integral transmembrane proteins > protection and defense. e.g., immunoglobin G > Control and regulation. e.g., receptors, and DNA binding proteins > Catalysis. e.g., enzymes CISC667, F05, Lec2, Liao

Small molecules: > fatty acids > sugar: carbohydrate > fatty acids > nucleotides: A, C, G, T (Purines: A and G; Pyrimidines: C and T) CISC667, F05, Lec2, Liao

Structure of the bases (Thymine is not shown here) 5 1 3 Purines:A and G Pyrimidines: C and T Oligonucleotide: a DNA of a few tens of nucleotides ATP, ADP, AMP CISC667, F05, Lec2, Liao

DNA (double helix, hydrogen bond, complementary bases A-T, G-C) 5' end phosphate group 3' end is free 1' position is attached with the base double strand DNA sequences form a helix via hydrogen bonds between complementary bases hydrogen bond: - weak: about 3~5 kJ/mol (A covalent C-C bond has 380 kJ/mol), will break when heated - saturation: - spefic: CISC667, F05, Lec2, Liao

The rules for base pairing (Watson-Crick base pairing) : A with T: the purine adenine (A) always pairs with the pyrimidine thymine (T) C with G: the pyrimidine cytosine (C) always pairs with the purine guanine (G) CISC667, F05, Lec2, Liao

Information Expression 1-D information array 3-D biochemical structure CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

Peptide bond CISC667, F05, Lec2, Liao

Polypeptide N-terminal C- terminal CISC667, F05, Lec2, Liao

Genetic Code: codons CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao

Gene Structure DNA Protein Exons 5’ regulatory domains Introns Transcriptional control Post-transcriptional processing: hnRNA to mRNA Protein Translation: mRNA to protein CISC667, F05, Lec2, Liao

How complex can a 4 letter code really be? atcgggctatcgatagctatagcgcgatatatcgcgcgtatatgcgcgcatattag tagctagtgctgattcatctggactgtcgtaatatatacgcgcccggctatcgcgct atgcgcgatatcgcgcggcgctatataaatattaaaaaataaaatatatatatatgc tgcgcgatagcgctataggcgcgctatccatatataggcgctcgcccgggcgcga tgcatcggctacggctagctgtagctagtcggcgattagcggcttatatgcggcga gcgatgagagtcgcggctataggcttaggctatagcgctagtatatagcggctagc cgcgtagacgcgatagcgtagctagcggcgcgcgtatatagcgcttaagagcca aaatgcgtctagcgctataatatgcgctatagctatatgcggctattatatagcgca gcgctagctagcgtatcaggcgaggagatcgatgctactgatcgatgctagagca gcgtcatgctagtagtgccatatatatgctgagcgcgcgtagctcgatattacgcta cctagatgctagcgagctatgatcgtagca……………………………………. CISC667, F05, Lec2, Liao

EST (expressed sequence tag) Reverse translation and transcription Alternative splicing Exception to the “One gene one protein” rule. Codon usage http://www.kazusa.or.jp/codon/ EST (expressed sequence tag) Reverse translation and transcription cDNA CISC667, F05, Lec2, Liao

Given a DNA sequence, we like to computationally Identify genes, introns, exons, alternative splicing sites, promoters, … Determine the functions of the protein that a gene encodes Identify functional signatures, e.g., motifs Determine the structure of proteins CISC667, F05, Lec2, Liao

CISC667, F05, Lec2, Liao