April 21, 2011 Why is DNA double stranded?

Slides:

Advertisements

Similar presentations

Chapter 13.3 (Pgs ): Mutations

Advertisements

Human Genetic Mutations

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

Gene Mutations Higher Human Biology Unit 1 – Human Cells.

MUTATIONS Section 11.3 pgs

12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.

3.4/7.2 DNA REPLICATION Two DNA molecules are constructed from one, therefore each new molecule contains one original strand and one new strand  a semi-conservative.

Section 11.3 MUTATIONS Section 11.3 pgs

Mutations And their effects. A mutation is…  A permanent change that occurs in a cell’s DNA.

Because Stuff Happens Mutations.

Ch Mutations Section Objectives:

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

Human Genetic Mutations

Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Gene Regulation and Mutation Notes and Questions How do mutations affect a cell?

GENETIC MUTATIONS What is this picture depicting?.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Because Stuff Happens. A. Mutation Overview  Any change or random error in the nucleotide sequence (either DNA or mRNA) is called a mutation  Can occur.

Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.

Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.

CHAPTER 14 SECTION 1 Mutations. Are mutations good or bad?  Some mutations lead to genetic disorders  Some mutations may cause a beneficial trait 

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

Gene Regulation Ability of an organisms to control which genes are present in response to the environment.

Because Stuff Happens. A. Mutation Overview  Any change or random error in the nucleotide sequence (either DNA or mRNA) is called a mutation  Can occur.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

12.4 Assessment Answers.

Big Q: What are mutations? Big Q: How do mutations affect genes?

Gene Mutations Chapter 11.

Mutation and Genetic Change

Gene Mutations.

A permanent change that occurs in a cell’s DNA is called a mutation.

Mutations 7.L.4A.5 Construct scientific arguments using evidence to support claims for how changes in genes (mutations) may have beneficial, harmful,

Human Genetic Mutations

Types of point mutations

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

11.3 Section Objectives – page 296

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Mutations Section 12-4.

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

December 19, 2017 Journal: What is the difference between how nucleotides are added to the leading and lagging strands in DNA replication?

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutations changes in genetic material (_____).

Mutation: Some Definitions

Chapter 17 Nucleic Acids and Protein Synthesis

Gene Regulation and Mutations

Presentation transcript:

April 21, 2011 Why is DNA double stranded? If I compared the DNA of a human to that of a whale, what similarities would they have? Differences? *** Bring up the handout from the BOOK (“Study Guide”); make sure your name is on it!

Mutations What are they? Can be Changes in DNA or RNA Sequence Beneficial Sickle Cell Anemia carriers are less likely to contract malaria Ability to digest lactose Neutral Harmful Genetic disorders

Mutations Can only be passed to future generations if they occur in a sex cell Aka gamete Sperm/egg

Types of Mutations: Least Harmful Point mutations Change in one base only Results in one amino acid change, early stop of translation, or no change at all Three types Silent Missense Nonsense

Types of Mutations: Least Harmful Silent mutation One base changes, no change in amino acid Original DNA: ATACGGCATGGGCACTAGG Original mRNA: UAUGCCGUACCCGUGAUCC Original AA: M, P, Y, P, Stop Mutated DNA: ATACGGCATGGGGACTAGG Mutated mRNA: UAUGCCGUACCCCUGAUCC Mutated AA: M, P, Y, P, Stop

Types of Mutations: Least Harmful Missense mutation One base changes and one amino acid changes Original DNA: ATACGGCATGGGCACTAGG Original mRNA: UAUGCCGUACCCGUGAUCC Original AA: M, P, Y, P, Stop Mutated DNA: ATACGGCAGGGGCACTAGG Mutated mRNA: UAUGCCGUCCCCGUGAUCC Mutated mRNA: M, P, S, P, stop

Epidermolysis bullosa Sickle Cell Anemia Some forms of Cystic Fibrosis (respiratory) & ALS (Lou Gehrig’s Disease, nervous system & muscles) Epidermolysis bullosa

Types of Mutations: Least Harmful Nonsense mutation One base changes, results in early stop (short protein) Original DNA: ATACGGCATGGGCACTAGG Original mRNA: UAUGCCGUACCCGUGAUCC Original AA: M, P, Y, P, Stop Mutated DNA: ATACGGCATCGGCACTAGG Mutated mRNA: UAUGCCGUAGCCGUGAUCC Mutated mRNA: M, P, stop

Duchenne Muscular Dystrophy Hurler Syndrome (disorder associated with lysosomes)

Types of Mutations: Next Harmful Frameshift mutation Base is added in or deleted, shifting the reading frame Many amino acids change, could end protein early or make it extra long Original DNA: ATACGGCATGGGCACTAGG Original mRNA: UAUGCCGUACCCGUGAUCC Original AA: M, P, Y, P, Stop Mutated DNA: ATACGGCATGTGGCACTAGG Mutated mRNA: UAUGCCGUACACCGUGAUCC Mutated AA: M, P, Y, T, V, I

Tay Sachs Disease

Types of Mutations: Most Harmful Chromosomal Large sections of DNA are flipped around, duplicated/copied, removed, etc

Charcot Marie Tooth Disease Jacobsen Disorder

Causes of Mutations Spontaneous (Random chance) Mutagens During DNA replication (copying) when cells divide During transcription (DNA  mRNA) Mutagens External things that increase likelihood of mutations occurring Radiation Chemicals (benzene, cyanide, asbestos, etc)

Repairing DNA Enzymes proofread DNA and RNA If enzymes are exposed to mutagens, they are likely to mutate and then won’t do their job correctly.