RIKEN Arabidopsis Transposon-tagged Mutant (RATM) Line Catalogue Database USER’S GUIDE.

Slides:

Advertisements

Similar presentations

Genetic Map to Physical Map This activity is intended to supplement the workshop session entitled Integrating the Genetic and Physical Maps of Maize. However,

Advertisements

The Arabidopsis Information Resource (TAIR)

Putting TAIR to work for you hands-on workshop for beginning and advanced users

Directorate of Learning Resources WARC World Advertising Research Center database Click on any option to explore the subjects using the sub menus that.

Extended DISC Online System User Instruction: How to Run a Work Pairing.

BLOSUM62. Sequencia desconhecida GTCACGTTACCGGTGGCCGAACAGGCCCGTCATGAAGTGTTCGATGTCGCGTCGGTCAGCGCGGCTGCCGCCCCAGTAAACA CCCTGCCGGTGACGACGCCGCAGAATTTGCAGACCGCCACTTACGGCAGCACGTTGAGTGGCGACAATCACAGTCGTCTGAT.

Mapping in Arabidopsis cont…

Why NCBI Tools are important for breeding plants studies genetically modified organism: the impossibility of intergenic crosses caused by the genetic incompatibility.

At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.

HC70AL Spring 2009 An Introduction to Bioinformatics By Brandon Le & Min Chen April 7, 2009.

Encyclopedia of Genetics, Genomics, Proteomics and Bioinformatics USC School of Medicine Library.

1.Generate mutants by mutagenesis of seeds Use a genetic background with lots of known polymorphisms compared to other genotypes. Availability of polymorphic.

Pennsylvania’s Protection From Abuse Database

Arabidopsis thaliana Katie Dalpozzo. Model Organism Small (20 cm),unremarkable spindly weed, with tiny, white, four-petalled flowers Six week lifespan.

Lab 3.41 Demo: Exploiting the UCSC Genome Browser Stefanie Butland UBC Bioinformatics Centre

Data Mining in Ensembl with EnsMart. 2 of 24 All genes from a candidate region Genes with a particular protein domain Members of a protein family Genes.

Genomic Database - Ensembl Ka-Lok Ng Department of Bioinformatics Asia University.

Enzymatic Function Module (KEGG, MetaCyc, and EC Numbers)

Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.

Genetic Map to Physical Map This activity is intended to supplement the workshop session entitled “Integrating the Genetic and Physical Maps of Maize”.

Using mutants to clone genes Objectives 1. What is positional cloning? 2.What is insertional tagging? 3.How can one confirm that the gene cloned is the.

Tutorial Guide no. 16 OVID DATABASE: GLOBAL HEALTH.

Forward genetics and reverse genetics

Arabidopsis Genome Annotation TAIR7 Release. Arabidopsis Genome Annotation  Overview of releases  Current release (TAIR7)  Where to find TAIR7 release.

1 The Genome Browser allows you to –Browse the Rice-Japonica, Maize and Arabidopsis genomes. –View the location of a particular feature on the rice genome.

Screening a Library Plate out library on nutrient agar in petri dishes. Up to 50,000 plaques or colonies per plate.

SAGExplore web server tutorial for Module II: Genome Mapping.

Use cases for Tools at the Bovine Genome Database Apollo and Bovine QTL viewer.

COURSE OF BIOINFORMATICS Exam_31/01/2014 A.

1 of 38 Data Mining in Ensembl with BioMart. 2 of 38 Simple Text-based Search Engine.

SAGExplore web server tutorial for Module I: Genome Explore.

Biological databases Exercises. Discovery of distinct sequence databases using ensembl.

HealthSmart Preferred Care, Inc On-Line Claim Status

Copyright OpenHelix. No use or reproduction without express written consent1.

Data Mining in Ensembl with BioMart Giulietta Spudich.

Copyright OpenHelix. No use or reproduction without express written consent1.

SAGExplore web server tutorial. The SAGExplore server has three different modules …

What do we already know ? The rice disease resistance gene Pi-ta Genetically mapped to chromosome 12 Rybka et al. (1997). It has also been sequenced Bryan.

SRB Genome Assembly and Analysis From 454 Sequences HC70AL S Brandon Le & Min Chen.

2006 ICAR: TAIR workshop Organizers: Katica Ilic and Peifen Zhang Location: Reception Room, 4th floor A general overview of TAIR website and demonstration.

IMDB: A Generic Insertional Mutagenesis Database Xiaokang Pan and Lincoln Stein Cold Spring Harbor Laboratory.

To add “free-text summary holdings” in the Cataloguing Wizard.

Step 1of 11 Admin Demonstrations Click Here to Start.

Welcome to the combined BLAST and Genome Browser Tutorial.

The TDR Targets Database Prioritizing potential drug targets in complete genomes.

Finding a gene based on phenotype Model organisms ’s of DNA markers mapped onto each chromosome – high density linkage map. 2. identify markers linked.

Section 10.1 Define scripting

Catalogue User Guide

SAGExplore web server tutorial for Module III:

From: RTCGD: retroviral tagged cancer gene database

Searching Discussion Boards for Student Posts

Map-based cloning of interesting genes

Catalogue User Guide

Pick a Gene Assignment 4 Requirements

GEP Annotation Workflow

PlantGDB: Annotation Principles & Procedures

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

A User’s Guide to GO: Structural and Functional Annotation

A database of Cross-border Regulation of microRNAs Shu xin

Annotation Presentation

Delete a Public Holiday – Holiday Calendar

Using mutants to clone genes

Schematic representation of proteogenomic annotation strategy.

Connect McGraw Hill Set Up

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Steps to register through Web Advisor

Builder/Rater Training Guide to Create a Project and Submit

Activity 2 – model answer

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Catalogue User Guide

Presentation transcript:

RIKEN Arabidopsis Transposon-tagged Mutant (RATM) Line Catalogue Database USER’S GUIDE

START YOUR SEARCH Select resource type psh: homozygous line pst: no information for zygosity Enter information Resource Number: named by RIKEN BRC, used in MTA and order forms Line name: named by RIKEN GSC AGI(TAIR10) code: gene number of Arabidopsis annotated by TAIR Click here to start search

CHECK CANDIDATE LINE LIST Gene(s) near the insertion site 5’: neighbor gene(s) predicted from the 5’-end flanking sequence 3’: neighbor gene(s) predicted from the 3’-end flanking sequence Candidate line(s) (click to open the information page) psh: homozygous line pst: no information for zygosity Line name (click to open the information page)

FIND DATA FOR EACH LINE Line name Ds insertion site information predicted from 5’- and 3’-end flanking sequence Candidate Position: location on the corresponding chromosome 5’1(1)/3’1(1): AGI code of the nearest gene and the position of Ds insertion 5’1(2)/3’1(2): additional gene information when the location of Ds insertion is intergenic Some lines have two or more candidate positions for Ds insertion. This is because of the redundancy in the Arabidopsis genome. Additional candidate site (when applicable)

GET MORE INFORMATION FROM RARGE DB (Optional, map position/flanking sequence available ) http://rarge-v2.psc.riken.jp/line Enter line name (Dsxx-xxxx-x) here RIKEN BRC confirms the insertion site before shipment. The information obtained from the analysis will be informed to the user.