Protein Synthesis Making Proteins

Slides:



Advertisements
Similar presentations
From Gene to Protein How Genes Work
Advertisements

Regents Biology Turn in DNA letter  Begin reading Analogy Story and answer the questions  Don’t worry about the back page.
Protein Synthesis Making Proteins
DNA, RNA, and Protein Section Objectives: By the end of this section of notes your should be able to: Relate the concept of the gene to the sequence of.
Regents Biology Protein Synthesis Making Proteins.
A. There are three key differences between RNA and DNA 1. RNA is single stranded : DNA is double stranded 2. RNA is made of the sugar Ribose – DNA is.
TRANSLATION/PROTEIN SYNTHESIS Unit 4 – Part 1. Central Dogma DNA mRNA Proteins Traits.
Transcription.
Goal 3.01b: Protein Synthesis and Gene Regulation.
Protein Synthesis Making Proteins  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA.
AP Biology From Gene to Protein How Genes Work.
Protein Synthesis Making Proteins
The Central Dogma Replication-> Transcription-> Translation Modified from Kim Foglia.
Relate the concept of the gene to the sequence of nucleotides in DNA.
RNA and Protein Synthesis Ribonucleic acid: another type of nucleic acid that works with DNA to make proteins.
CH : DNA, RNA, and Protein Section Objectives: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved.
Chapter 8: From DNA to Protein Section Transcription
RNA, Transcription, Translation
Structure of DNA DNA is made up of a long chain of nucleotides
Regents Biology From gene to protein: transcription translation protein.
Protein Synthesis Making Proteins
Protein Synthesis and Common DNA 3 rd Six Weeks, 1 st subject (3.1) Notes will be posted on Netschool.
Aim: How are proteins synthesized? What are the main jobs of DNA? Replication & Protein Synthesis.
What is DNA? What does it do? DNA The Genetic Material Chapter 12: DNA.
RNA Transcription, Translation and Protein Synthesis.
NOTE: This presentation was not made for public use. Please do not use this presentation without my permission and the permission of each of the authors.
Protein Synthesis Making Proteins DNAmRNA tRNA Protein.
Genetics.
Protein Synthesis DNA Gene mRN tRNA Amino Acid Protein Nucleus
Get out worksheet from yesterday and Nucleotides
From gene to protein DNA mRNA protein trait nucleus cytoplasm
Protein Synthesis Making Proteins
RNA.
Do Now: Imagine you have an original Michaelangelo painting
Honors Biology Chapter 12
Transcription and Translation Video Notes
Protein Synthesis.
From Gene to Protein.
Objective: Journal: Describe the process of protein synthesis
DNA Deoxyribonucleic Acid The Blueprint of Life
Transcription and Translation
Chapter 12: From Genes to Proteins
Protein Synthesis 101 Not only does every nucleus of every cell contain the information to make a new you it also contains the information to make all.
from nucleic acid language to amino acid language
Analyze the process of DNA replication.
Protein Synthesis Using DNA to Make Proteins
Protein Synthesis Making Proteins
Nucleic Acids: RNA Ribonucleic Acid: RNA
Protein Synthesis: An Overview
Protein Synthesis Making Proteins
January 11, 2018 Objective: Journal:
Protein Synthesis RNA.
Protein Synthesis Making Proteins
DNA Transcription and Translation
Protein Synthesis: Translation
DO NOW.
Steps of Translation.
Genetics: A whole new look at “who’s who.”
How does DNA create action?
Do Now: Imagine you have an original Michaelangelo painting
Transcription and Translation
DNA Replication Living Environment 2015.
Protein Synthesis - Making Proteins
Enter Date Aim: Making Proteins Warm-up: HW:.
Protein Synthesis.
Protein Synthesis.
Big Q: What role does the ribosome play in assembling proteins?
Protein Synthesis: An Overview
Protein Synthesis Making Proteins
from nucleic acid language to amino acid language to PROTEIN language
Presentation transcript:

Protein Synthesis Making Proteins 2009-2010

Bodies  Cells  DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA

DNA  Cells  Bodies How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA

DNA  Proteins  Cells  Bodies DNA has the information to build proteins genes proteins cells DNA gets all the glory, Proteins do all the work bodies

How do proteins do all the work proteins run living organisms enzymes control all chemical reactions in living organisms structure all living organisms are built out of proteins

Cell organization DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus

Cell organization Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome cytoplasm nucleus build proteins ribosome

Passing on DNA information Need to get DNA gene information from nucleus to cytoplasm need a copy of DNA messenger RNA cytoplasm nucleus build proteins mRNA ribosome

From nucleus to cytoplasm transcription DNA mRNA protein translation trait nucleus cytoplasm

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

Transcription Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

cytoplasm protein nucleus ribosome U C A G trait

How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How? mRNA U C A G aa

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon = block of 3 mRNA bases

The mRNA code For ALL life! Code has duplicates Start codon strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

mRNA to protein = Translation The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

DNA mRNA protein trait From gene to protein tRNA transcription aa transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus cytoplasm

cytoplasm protein transcription translation nucleus trait

From gene to protein protein transcription translation

Whoops! See what happens when your genes don’t work right! Any Questions?? 2009-2010