9 Future Challenges for Bioinformatics

Slides:



Advertisements
Similar presentations
Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB
Advertisements

CPL The Convergence of Bioinformatics and Medical Informatics -- PL Chang, M.D.
UTACCEL 2010 Adventures in Biotechnology Graham Cromar.
BIOINFORMATICS GENE DISCOVERY BIOINFORMATICS AND GENE DISCOVERY Iosif Vaisman 1998 UNIVERSITY OF NORTH CAROLINA AT CHAPEL HILL Bioinformatics Tutorials.
Characterization of Transcriptional Regulatory Networks controlling plant cell adaptation to environmental stresses.
Gene Regulation in Eukaryotic Cells. Gene regulation is complex Regulation, and therefore, expression of a gene is complex. Regulation of these genes.
Genomics: READING genome sequences ASSEMBLY of the sequence ANNOTATION of the sequence carry out dideoxy sequencing connect seqs. to make whole chromosomes.
Biological pathway and systems analysis An introduction.
Prof. Carolina Ruiz Computer Science Department Bioinformatics and Computational Biology Program WPI WELCOME TO BCB4003/CS4803 BCB503/CS583 BIOLOGICAL.
Bioinformatics David Brodin BEA core facility MOLEKYLÄRBIOLOGI MED GENETIK – BIOINFORMATIK HT -07 Course web page:
4.A.3 Cell Specialization Interactions between external stimuli and regulated gene expression result in specialization of cells, tissues and organs.
Using Bioinformatics to Make the Bio- Math Connection The Confessions of a Biology Teacher.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
Introduction to Genomics, Bioinformatics & Proteomics Brian Rybarczyk, PhD PMABS Department of Biology University of North Carolina Chapel Hill.
BACKGROUND E. coli is a free living, gram negative bacterium which colonizes the lower gut of animals. Since it is a model organism, a lot of experimental.
Algorithms in Computational Biology Tanya Berger-Wolf Compbio.cs.uic.edu/~tanya/teaching/CompBio January 13, 2006.
Bioinformatics Original definition (1979 by Paulien Hogeweg): “application of information technology and computer science to the field of molecular biology”
Topics in Computational Biology (COSI 230a) Pengyu Hong 09/02/2005.
Understanding Drosophila Development at the Molecular Level Gene Myers EECS, UCal, Berkeley.
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl
Cell signaling Cells do not work in isolation but continually ‘talk’ to each other by sending and receiving chemical signals to each other. This process.
Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.
9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.
Formal Empirical Applied Mathematical and technical methods and theories Cognitive, behavioral, and organizational techniques and theories ImagingBioInformaticsClinical.
AP Biology Control of Eukaryotic Genes.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Problem Statement and Motivation Key Achievements and Future Goals Technical Approach Investigators: Yang Dai Prime Grant Support: NSF High-throughput.
Genomics, Proteomics, and Bioinformatics Biology 224 Instructor: Tom Peavy January 29, 2008.
Information Systems Basic Core Specialization Clinical Imaging BioInformatics Public Health Computer Science Methods (formal models) Biomedical Decision.
Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.
Introduction to Bioinformatics Spring 2002 Adapted from Irit Orr Course at WIS.
Current Challenges in Bioinformatics Based on talk given at SPIRE 2003 Manaus, Brazil João Meidanis.
Finish up array applications Move on to proteomics Protein microarrays.
8.6 Gene Expression and Regulation TEKS 5C, 6C, 6D, 6E KEY CONCEPT Gene expression is carefully regulated in both prokaryotic and eukaryotic cells.
Pattern Matching Rhys Price Jones Anne R. Haake. What is pattern matching? Pattern matching is the procedure of scanning a nucleic acid or protein sequence.
Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.
Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill
The Mammalian Protein – Protein Interaction Database and Its Viewing System That Is Linked to the Main FANTOM2 Viewer Genome Research (2003) Speaker: 蔡欣吟.
Eukaryotic Gene Prediction Rui Alves. How are eukaryotic genes different? DNA RNA Pol mRNA Ryb Protein.
Jobs, Careers, Internships, Senior Projects and Research Computer Application Development K-12 education Industrial Training Bioinformatics Validation.
An approach to carry out research and teaching in Bioinformatics in remote areas Alok Bhattacharya Centre for Computational Biology & Bioinformatics JAWAHARLAL.
1 Bioinformatics at Norwegian University of Science and Technology Professor Finn Drabløs Department of Cancer Research and Molecular Medicine Finn Drabløs.
Cell Communication (Chpt. 11) Chapter 11. Overview of Cell Signaling Signaling evolved early in history of life Communicating cells may be close together.
داده های عظیم در دوران پساژنوم Big Data in Post Genome Era مهدی صادقی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری پژوهشکده علوم زیستی، پژوهشگاه دانش های بنیادی.
BIOINFORMATICS Ayesha M. Khan Spring 2013 Lec-8.
Show & Tell Limsoon Wong Kent Ridge Digital Labs Singapore Role of Bioinformatics in the Genomic Era.
BNFO 615 Fall 2016 Usman Roshan NJIT. Outline Machine learning for bioinformatics – Basic machine learning algorithms – Applications to bioinformatics.
BME435 BIOINFORMATICS.
High-throughput data used in bioinformatics
Control of Gene Expression
Whole-cell models: combining genomics and dynamical modeling
Biomedical Therapies Foundation Standard 1: Academic Foundation
Dept of Biomedical Informatics University of Pittsburgh
Concept 4: Analyzing Cell Communication
Expression of Human Genes
What is Pattern Recognition?
محاضرة عامة التقنيات الحيوية (هندسة الجينات .. مبادئ وتطبيقات)
Cell Signaling.
Genome organization and Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Introduction to Bioinformatics II
From Data to Therapies Research in Xinghua Lu’s Lab
Introduction to Gene Expression
DNA Structure and Function
Patterns of control of gene expression
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Unit III Information Essential to Life Processes
The Study of Biological Information
Introduction to Bioinformatic
Introduction to Bioinformatics
Presentation transcript:

9 Future Challenges for Bioinformatics Adapted from an article by: E. Birney, C. Burge, and J. Fickett, Genome Technology, issue 17, Jan. 2002

9 Future Challenges for Bioinformatics #1: Precise model of transcription initiation and termination: ability to predict where, when, and at what rate transcription will occur

Endo16 Regulatory Network

9 Future Challenges for Bioinformatics #2: Precise model of RNA splicing: ability to predict the splicing pattern of any primary transcript in any tissue

9 Future Challenges for Bioinformatics #3: Precise model of signal transduction pathways: ability to predict cellular responses to external stimuli

EGF Recepter Signaling Pathway

9 Future Challenges for Bioinformatics #4: Precise model for the following binding interactions: protein-DNA protein-RNA protein-protein RNA-RNA

Zinc Finger – DNA Binding

9 Future Challenges for Bioinformatics #5: Accurate ab initio RNA structure prediction

SARS s2m RNA

9 Future Challenges for Bioinformatics #6: Accurate ab initio protein structure prediction

Structure of β-amylase

9 Future Challenges for Bioinformatics #7: Rational design of small molecule inhibitors of proteins

Fasciculin Docked with AChE

9 Future Challenges for Bioinformatics #8: Development of gene ontologies: systematic ways to describe and predict the functions of any gene or protein

9 Future Challenges for Bioinformatics #9: Precise model of evolution: understanding exactly how biological sequences evolve

HERV-K Retrovirus Insertions

Other Challenges Development: how do cells specialize? Speciation: what is the mechanism? Disease models: diagnosis, prognosis, treatment Drug design: discovery, validation, development Individualized medicine

Relevant Math. & Comp. Sci. Probability and statistics Combinatorics Information theory Mathematical modeling Algorithm design and analysis Databases Machine learning Text mining, natural language processing Image processing User interfaces