Protein Synthesis.

Slides:



Advertisements
Similar presentations
Chapter 10 How proteins are made.
Advertisements

RNA and Protein Synthesis
CH 11.4 & 11.5 “DNA to Polypeptide”.
Chapter 13: RNA and Protein Synthesis
 Assemble the DNA  Follow base pair rules  Blue—Guanine  Red—Cytosine  Purple—Thymine  Green--Adenine.
RNA Ribonucleic acid single stranded also made of nucleotides.
Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
VII RNA and Protein Synthesis
From Gene To Protein Chapter 17. From Gene to Protein The “Central Dogma of Molecular Biology” is DNA  RNA  protein Meaning that our DNA codes our RNA.
Transcription & Translation Chapter 17 (in brief) Biology – Campbell Reece.
RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Transcription vs Translation. Central Dogma Transcription Translation.
RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
Journal #4: In DNA, which nucleotide pairs with Adenine? Guanine? Which DNA nucleotide is not represented in RNA? Fun Fact: Every human spent about half.
RNA and Protein Synthesis
Protein synthesis DNA is the genetic code for all life. DNA literally holds the instructions that make all life possible. Even so, DNA does not directly.
What is Transcription? Transcription is the transfer of genetic information from DNA into messengerRNA (mRNA). It occurs in the nucleus of the cell.
Transcription and Translation
(3) Gene Expression Gene Expression (A) What is Gene Expression?
RNA & Protein synthesis
What is gene expression? Gene Expression and Protein Synthesis The Genetic Code Gene-a section of DNA that codes for an amino acid sequence.
Transcription Part of the message encoded within the sequence of bases in DNA must be transcribed into a sequence of bases in RNA before translation can.
From Gene to Protein Chapter 17.
Chapter 5 RNA and Transcription
Transcription & Translation
Protein Synthesis Genetics.
Transcription Modeling
RNA and Protein Synthesis
Protein Synthesis in Detail
Transcription and Translation
RNA.
Transcription & Translation.
Transcription.
Protein Synthesis Chapter 10.
DNA & Protein Synthesis
The Importance of Proteins
Take 5 What is the product of DNA replication?
From Genes to Proteins.
RNA and Transcription DNA RNA PROTEIN.
13.1: RNA & Transcription.
RNA: Structures and Functions
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
RNA.
GENE EXPRESSION / PROTEIN SYNTHESIS
12-3 RNA and Protein Synthesis
Transcription/ Translation
Comparison of DNA and RNA
copyright cmassengale
From Genes to Proteins.
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
RNA and Protein Synthesis
Replication, Transcription, Translation
Copyright Pearson Prentice Hall
DNA Transcription and Translation
RNA & Protein Synthesis
RNA.
12-3 RNA & Protein Synthesis
12-3: RNA and Protein Synthesis (part 1)
Protein Synthesis.
Protein Synthesis.
The Production of Proteins by DNA
Presentation transcript:

Protein Synthesis

Learning Goals What to know: Relationship between DNA, genes, amino acids, and proteins DNA vs RNA Steps of transcription & translation Coding for specific amino acids

Gene Expression Protein- is a long string of amino acids that fold into various structures Gene: segment of DNA that specifies the amino acid (AA) sequence of a protein

Production of RNA RNA- Ribonucleic Acid This is not making a mRNA on the ENTIRE DNA strand…..JUST THE GENE link between DNA & Protein synthesis single strand, single helix, Uracil not Thymine

Something new you learned Something surprising you learned Watch linked video In your notes: Something new you learned Something surprising you learned A question you still have

DNA makes RNA in nucleus 3 types of RNA: 1. Messenger (mRNA)- takes DNA message to ribosome 2. Ribosomal (rRNA) - make up ribosome (with proteins) 3. Transfer (tRNA) - brings amino acids to ribosomes

Protein Synthesis Steps Gene Expression- production of a protein 2 steps: 1. Transcription- DNA copied into mRNA 2. Translation- mRNA directs the sequence of AA in a polypeptide

Part 1 - Transcription Transcription of mRNA RNA Polymerase binds tightly to Promoter (TATA box) Promoter is a region of DNA that contains special sequence of nucleotides RNA Polymerase opens open DNA & joins RNA nucleotides to DNA (complimentary)

Transcription Cont’d -Processing- Add Guanine cap to 5’ end of RNA and Poly-A tail (AAAAAA) to 3’ end of RNA Introns, segments of DNA with no gene function, are cut out leaving only exons get to leave nucleus Exons spliced together is the finished RNA strand

Transcription Steps

Part 2 - Translation mRNA goes to ribosome The mRNA tells what order the amino acids should be in to make the protein

Translation The Code Codon- 3 letters unit of mRNA 64 different codons but only 20 different aa You will get handout

Translation b) Transfer RNA (tRNA) Bring the amino acid (aa) to the ribosomes at least 1 tRNA molecule for each of 20 aa aa binds to one end of tRNA Other end has anticodon which is complimentary to a specific codon of mRNA RNA-amino acid complex goes to ribosome and its anticodon pairs with mRNA codon

Translation 1. Initiation 2. Elongation 3. Termination

Let’s practice reading the code: DNA is: 3’TATAGTACAATACTGAACATTUCTTGC5’ What is the mRNA? What is the amino acid sequence?

Crafty Time  Each table team will get a ziplock bag of protein synthesis parts “act out” the process of protein synthesis using the paper pieces Complete the attached booklet with the codes that you create

Video Time You are going to make a video showing your understanding of protein synthesis You will work in partners You can use the ipads to create either a whiteboard marker sped up video, or a playdough video (see samples)

Video Samples Due to watch Monday, Oct 15th at START of class Whiteboard video Playdough video Due to watch Monday, Oct 15th at START of class

Apps to Use for Video