Bioinformatics & Social Conundrums

Slides:



Advertisements
Similar presentations
Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB
Advertisements

A PowerPoint for *****!! *photo of young person*.
A Career in Genetic Engineering In Livestock
Welcome Each of You to My Molecular Biology Class.
Integration of Bioinformatics into Inquiry Based Learning by Kathleen Gabric.
Human Molecular Genetics Section 14–3
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Bioinformatics for Stem Cell Lecture 1 Debashis Sahoo, PhD.
Introduction to Bioinformatics Prologue. Bioinformatics Living things have the ability to store, utilize, and pass on information Bioinformatics strives.
3/12/ th Day of School Learning goal (7.L.2): I will be able to demonstrate my knowledge of how to describe, identify, and apply understanding of.
Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill
Genetic Engineering Notes. Prior Knowledge 1. What do you know about genetic engineering? Cloning? Selective breeding?
Integration of Bioinformatics into Inquiry Based Learning by Kathleen Gabric.
EXCEL VS. GOOGLE DOCS SPREADSHEET Or: You have how normal software functions, and then you have, well…Google docs.
Properties of Life  1. Cellular Organization – all living things show an orderly structure Cell  Tissue  Organ  Body System  Organism Cell  Tissue.
Biochemist Duncan Burdick 5/9/14 2 nd Hour. Introduction “Once we accept our boundaries, we go beyond them.” – Albert Einstein You may not have heard.
Chemistry App Review By Stan Bagh October My Goal? Review an App About Chemistry. There were many apps I found on the google play store, but most.
Maximal D-segments Maximal-scoring No subsegment has higher score No segment properly containing the segment satisfies the above No supersegment has higher.
Peer Review – how scientists get their homework marked The Babraham Institute Babraham, Cambridge Designed by Cassandra Hogan, Hakim Yadi and Helen Craig.
Genetic Algorithms 11-Oct-17.
AP CSP: Making Visualizations & Discovering a Data Story
Using BLAST to Identify Species from Proteins
Bioethics Writing Assignment
Introduction to Bioinformatics and Functional Genomics
Introduction to Eclipse
Biological Databases By: Komal Arora.
Gil McVean Department of Statistics
The problems of teenagers Egorova Polina 10 form.
Section 2: Biology, Technology, and Society
THIS IS TO EVIDENCE YOUR WORK AND GET THE BEST GRADE POSSIBLE
Section 2: Biology, Technology, and Society
Part III – Gathering Data
Journal Writing Ideas.
Click to watch the 25 Genomes introductory video
Observations & Inferences
Biotechnology.
Bioinformatics (or making apples as big as a house)
Olweus Activity – 11/13/15 World Kindness Day
Using BLAST to Identify Species from Proteins
Impact of Formal Methods in Biology and Medicine
Impact of Formal Methods in Biology and Medicine
Indigene Project: Systems Biology Project
A Few Things to Think About
Rick, the SkyServer is a website we built to make it easy for professional and armature astronomers to access the terabytes of data gathered by the Sloan.
Scientific Method.
Genome organization and Bioinformatics
What is an Ontology An ontology is a set of terms, relationships and definitions that capture the knowledge of a certain domain. (common ontology ≠ common.
Writing Project By: Becca Wolfe.
Conv1 Exam Prep..
Nancy Baker SILS Bioinformatics Seminar January 21, 2004
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Session I Database & Data Mining Speaker: Mehmet M. Dalkilic
The Future of Genetic Research
Bioinformatics Vicki & Joe.
BIOINFORMATICS Summary
Genetic Algorithms 25-Feb-19.
Section 2 Vocabulary with video supports Access Biology
Empowering Beliefs Lesson 1 What are Empowering Beliefs?
Genetic Algorithms 26-Apr-19.
Applying principles of computer science in a biological context
Biological Science Applications in Agriculture
how organisms relate to each other and their environment
Using BLAST to Identify Species from Proteins
Dr.s Khem Ghusinga and Alan Jones
Unit 20 New Frontiers Lesson1 Futurology.
Genome Editing Should we have the option to change DNA in babies?
DNA and Modern Genetics
Oral Bagrut Preparation
Presentation transcript:

Bioinformatics & Social Conundrums I202 Social Informatics Bioinformatics & Social Conundrums Mehmet M. Dalkilic I202 March 26 07 © M.M. Dalkilic

Bioinformatics © Indiana University 2007 “Systems biology is the science of discovering, modeling, understanding and ultimately engineering at the molecular level the dynamic relationships between the biological molecules that define living organisms” Leroy Hood Institute for Systems Biology http://www.systemsbiology.org/ Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Bioinformatics © Indiana University 2007 Outline (I) A quick (another) set of definitions (II) A set of possibilities (III) Questions about the possibilities (IV) Summary & Prelude to Discussion Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Bioinformatics © Indiana University 2007 Perspectives "There's millions and millions of unsolved problems. Biology is so digital, and incredibly complicated, but incredibly useful. …. It is hard for me to say confidently that, after fifty more years of explosive growth of computer science, there will still be a lot of fascinating unsolved problems at peoples' fingertips, that it won't be pretty much working on refinements of well-explored things. Maybe all of the simple stuff and the really great stuff has been discovered. It may not be true, but I can't predict an unending growth. I can't be as confident about computer science as I can about biology. Biology easily has 500 years of exciting problems to work on, it's at that level." - It is hard for me to say confidently that, after fifty more years of explosive growth of computer science, there will still be a lot of fascinating unsolved problems at peoples' fingertips, that it won't be pretty much working on refinements of well-explored things. I can't be as confident about computer science as I can about biology. Biology easily has 500 years of exciting problems to work on, it's at that level. Donald Knuth (very famous CS guy) Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Bioinformatics © Indiana University 2007 Perspectives Computer science is no more about computers than astronomy is about telescopes. Edsger Dijkstra (another famous CS guy) Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Bioinformatics © Indiana University 2007 Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Bioinformatics © Indiana University 2007 Life (Cenral Dogma) Replication Transcription Translation Life & Stuff Thursday, December 27, 2018 Bioinformatics © Indiana University 2007 www.swbic.org/products/clipart/clipart.php

Bioinformatics © Indiana University 2007 Life (Cenral Dogma) Technology allows us to explicitly affect the outcomes and even the “Dogma” itself Replication ACTTCTG… Transcription TGU… Translation Life & Stuff Thursday, December 27, 2018 Bioinformatics © Indiana University 2007 www.swbic.org/products/clipart/clipart.php

Bioinformatics © Indiana University 2007 Life (Cenral Dogma) Every organism has a “genome” or book of instructions Each book is hard to decipher—most are jumbled up—so we pick passages called “genes” All books are related through evolution, so understanding one book, allows to understand others (through genes mostly now) Fly Book ACTAAGAAA ATCCTCTG GTTC…. Human ACTAAGAAA ATCTTCTG GTTC…. Fly Book ACTAAGAAA Aeye-colorTG GTTC…. 1 (read book) 3 (look for similar passage) 2 (decode gene) Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Possibilities (obvious choices) Choose the “phenotype” you want! Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Possibilities (obvious choices) URL: http://www.expasy.org/sprot Click “Advanced search in the UniProt Knowleabase Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Possibilities (obvious choices) URL: http://www.expasy.org/sprot Click “Advanced search in the UniProt Knowleabase Type “obesity” in description and then click “submit query” Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Possibilities (obvious choices) 4. Click on LEP_HUMAN P41159 Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Possibilities (obvious choices) 5. Scroll to the bottom to see the “gene” product (protein) Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Bioinformatics © Indiana University 2007 Possibilities Screen population for “criminal” gene Screen population for “healthiness” Cure “old-age” Create biological weapon—make enemy blind, deaf, confused, obedient Change food to be healthier Grow body parts, blood, stronger animals Create machine/organic communication links to allow fast, efficient downloading of information to people Use DNA to validate purchase Clone wealthy, powerful, famous people Get a dog’s sense of smell Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Bioinformatics © Indiana University 2007 Possibilities Screen population for “criminal” gene Screen population for “healthiness” Cure “old-age” Create biological weapon—make enemy blind, deaf, confused, obedient Change food to be healthier Grow body parts, blood, stronger animals Create machine/organic communication links to allow fast, efficient downloading of information to people Use DNA to validate purchase Clone wealthy, powerful, famous people Get a dog’s sense of smell Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Bioinformatics © Indiana University 2007 Questions For my birthday, I’d like get Super-Hero genes—and some for my dog too! It seems as though technology is disinterested in the direction it takes—is this really true? How can something (technology) that might so radically change our existence, be so little scrutinized? Scientist often claim “science” (knowledge about our existence) is impartial. Technology and science have become inexorably intertwined—improving our knowledge and ways to affect it. Can this mix be divorced from morality, politics, ethics, and religion? Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

“Homework” & Discussion Nice collection of readings Thursday, December 27, 2018 Bioinformatics © Indiana University 2007

Bioinformatics © Indiana University 2007 Thanks to everyone Email me if you’d like to discuss anything http://www.informatics.indiana.edu/dalkilic Thursday, December 27, 2018 Bioinformatics © Indiana University 2007