CRISPRs and Tandem Repeats A brief introduction & presentations by: Ellen Korcovelos, Min Im, Shaun Norris, Michael Stueland

What are Tandem Repeats? Tandem repeats are short units that repeat one after another They are important in disease, inheritance/forensics When we first sequenced a genome we had a bunch of nucleotides, which seemed random Now we know better. Repeated sequences occur in a variety of patterns Tandem repeats are when short units that repeat one after another

Well then what’s a CRISPR? Clustered Regularly Interspersed Short Palindromic Repeats Basically a special type of tandem repeat They provide a genetic level of immunity of bacteria CRISPRS and their associated protiens (Cas) provide interference for

A Project By: Shaun Norris CRISPR Regions Relative to Gene Locations in Related Strains of Bacteria A Project By: Shaun Norris

We know what CRISPRs are but... We don’t know where they are! But who cares? I mean what does gene location tell us? We set out here to explore what genes/gene types surrounding CRISPR locations It is known that CRISPRs are often associated with CAS proteins The gene-centered view of evolution, gene selection theory, or selfish gene theory holds that adaptive evolutionoccurs through the differential survival of competing genes, increasing the frequency of those alleles whose phenotypiceffects successfully promote their own propagation, with gene defined as "not just one single physical bit of DNA [but] all replicas of a particular bit of DNA distributed throughout the world".[1] The proponents of this viewpoint argue that, since heritable information is passed from generation to generation almost exclusively by genetic material, natural selection and evolution are best considered from the perspective of genes.

How to... Picked similar strains of Streptoccous/Staphlyoccous from Biobike CRISPR finder on their sequences Coordinates brought in to biobike and the genes surrounding theses sites were mapped

Results

Results

Results It confirms that most CRISPR regions are associated with Cas proteins[1]

Discussion Not well automated presently Analysis of more species is needed to provide a stronger conclusion Results were reviewed for similarities - e.g. look for similar genes that surround these CRISPR regions

The Existence of common sharing CRISPR among Lactobacillus Min Im

E. Coli According to Touchon et al (2010) Common Sharing CRISPR in E.Coli strains Repeat1: GGTTTATCCCCGCTGGCGCGGGGAACAC Repeat2: GGTTTATCCCCGCTGGCGCGGGGAACTC Repeat3: GTTCACTGCCGTACAGGCAGCTTAGAAA

Lactobacillus •Availablilty in Biobike –Lactobacillus-acidophilus-NCFM –Lactobacillus-brevis-ATCC-367 –Lactobacillus-casei-ATCC-334 –Lactobacillus-delbrueckii-subsp-bulgaricus-ATCC-BAA-365 –Lactobacillus-gasseri –Lactobacillus-johnsonii-NCC-533 –Lactobacillus-plantarum-WCFS1 –Lactobacillus-reuteri-F275

Lactobacillus-acidophilus-NCFM Using “counts-of-k-mers.bike” 28-nt sequence with 15 repeats with 61 spacers

Lactobacillus-brevis-ATCC-367 27-nt sequence with 13 repeats with 18-nt spacers 26-nt sequence with 13 repeats

Can CRISPR be found in each other? Lactobacillus-acidophilus GGATCACCTCCACATACGTGGAGAAAAT (28-nt) Lactobacillus-brevis TTGCCGCTGAATCCGTCGTTGCCGCTG (27-nt) TTGCCGCTGAATCCGTCGTTGCCGCT (26-nt) None found each other…

Maybe... Different CRISPR in other Lactobacillus organisms No common sharing CRISPR

Determination of Tandem Repeats in the Genomes of Two Strains of E Determination of Tandem Repeats in the Genomes of Two Strains of E. coli and Their Bacteriophages Ellen Korcovelos

Questioning what’s known 2 specific strains: Sakai and EDL933 Shiga-toxin (Stx1 and Stx2) Toxin-encoding bacteriophages? With repeats? Scientists have found two specific strains of O157:H7 that are associated with shiga-toxin producing agents. This toxin, when ingested by humans, causes diarrhea, and in worse scenarios, hemorrhagic colitis. In specifically focusing on tandem repeats within the E coli genome, I found that there are 6 known cases of tandem repeats within the two strains. After I saw this, I began to wonder if bacteria and the bacteriophages that infect them both contain the same repeats or portions of the same repeats.

Methods Find known repeated sequences Locate them in BioBIKE Display string of repeats

Results Stx1 vs. EDL933 Stx2 vs. EDL933 Stx1 vs. Sakai Stx2 vs. Sakai What to expect: Contained the repeats → phages underwent recombination with the host Partial repeats → evolutionary similarity with the host If no repeats were found at all? Does the phage need these genes in the first place?

What does this tell us? Recombinance within the phage Inserted sequences into host None of the above

CRISPRS and Immunity By: Michael Stueland

CRISPRs as an Immune Response CRISPR's have two regions: Direct repeat sequences Variable spacer sequences These sandwich each other. Spacer sequences match closely with phage DNA Derived CRISPR RNA (crRNA) can identify invading phage DNA

Are there any Bacterial CRISPRs that match known phage sequences? If a spacer sequence matches a region on a phage genome, the bacteria has likely come in contact with that phage before.

First step: Find CRISPR regions In order to do anything, a CRISPR region must first be identified. CRISPR regions have repeating sequences between 23 to 47 base pairs[1]. So: if the repeating sequence can be found, then spacing sequences can also be found

First step: Find CRISPR regions In Biobike, a genome can be scanned for any sequence that repeats multiple times. However, repeat sequences need to be clustered.

Genome can be split into chunks, and each analyzed. This gives ability to find clustered repeats.

Repeat sequence found in C. tetani Green regions are repeats Repeat = 30 base pairs Variable regions range between 35 – 39 base pairs, 37.8 average

Step 2: Compare to phage genomes Spacer sequence list acquired Find similar matches by searching available phage genomes Exact matches unlikely as viruses mutate rapidly, find similar sequences allowing for a few base pair differences

Possible match found Spacer sequence and Match: AATGAAGTCAAATAATAACATACCATTTTGTGCTC AATAATAACATACCATTTT Chance of occurring randomly in genome the size of organism's: 9.18 x 10-7 Match: Prochlorococcus-phage Unlikely C. tetani ran into this phage, as the bacterium it infects is a cyanobacterium that lives in the ocean.

Another CRISPR found Located in Nitrosomonas europaea No Corresponding phage genome available

Another CRISPR sequence Mycobacterium tuberculosis Interesting feature: CRISPR interrupted by an unknown theoretical protein Repeats each 35 BPs long

Viable Match

Viable match

Another Match

Phage genome

Finding: Four likely matches between Bacterium in the mycobacterium genus and macobacterium phages found. Probability of these occurring randomly very low Likely that bacterium had encountered phage genomes in ancestory Bacterium likely has some immunity to mycobacterium phages

References [1] Horvath, P., Barrangou, R. January 2010. CRISPR/Cas, the Immune System of Bacteria and Archaea. Science. 327(5962): 167-170 Graphics taken from:Nakagawa labrtory website, http://www.tmd.ac.jp/grad/bac/EnglishCRISPR.html, and American Society for Microbiology website, http://schaechter.asmblog.org/schaechter/2011/04/six- questions-about-crisprs.html