Supplemental Figure S2: G2 arrest in MCF7-shPBK1 stable cell line

Slides:

Advertisements

Similar presentations

Supplemental figure 1 ROS production in MM cell line (KMM1) treated with bortezomib and DCA. ROS production was marginally increased by DCA in combination.

Advertisements

1.96E E E E E E+07 0E+0 1E+7 2E+7 3E+7 4E+7 5E+7 6E07 7E+7 8E+7 9E+7 hWASP1 Cell Growth Cell Number Days of Growth.

P-ERK Total ERK Mel888 CHL1 WM BRAFi (nmol/L) Supplemental Figure 2: Other surface molecules unaffected ns PD-L1 ns MCSP DMSO BRAFi Supplemental.

Supplemental Figure 1 A No. at risk T T T

Supplementary Material. Supplemental Fig. 1. Celastrol restored the cardiac function in a DOX induced cardiomyopathy model. The DOX group showed a reduction.

Supplemental Figure 1: Chemical structures of fludioxonil and fenhexamid. FludioxonilFenhexamid.

Supplemental figure A FA-D2 +FANCD2 FA-D2 +FANCD2(K561R) No HU 0.1mM HU S phase: 43%S phase: 34.7% S phase: 30.8% S phase: 52.7%S phase: 25.4%S phase:

Knight et al – Supplementary Table Supplemental Table 1: Cell line Densitometry AROSSIRT1 ARPE WI MCF10A HCT HCT116.

P449. p450 Figure 15-1 p451 Figure 15-2 p453 Figure 15-2a p453.

P247. Figure 9-1 p248 Figure 9-2 p251 p251 Figure 9-3 p253.

3D Micromanufacturing Lab. [1] Clean Bench. [2] 3D Micromanufacturing Lab. What is a clean bench Clean bench is a working platform which provides contamination.

ER  HSP90 DMSO 200  M I3C30  M DIM200  M TRYPTOPHOL Supplemental Figure 1. DIM and Tryptophol fail to induce the downregulation of ER  seen with I3C.

Supplemental Figure 1. The wxr3 mutant exhibits decreased expression of CYCB1;1, SCR and SHR compared with the control. A and B, Expression of ProCYCB1;1:GUS.

Figure 1 B D DOX ( μ M) C Cell Proliferation (% Con) MCF-7MCF-7/DOX DOX ( μ M) 0.03% 38.79% 0.15% 0.10% 0.20% 0.05%

IFNγIL-2TNFaIL-17A CD40 L MOPP DMSO CD4+ Supplemental figure 5A SEB isotype control isotype control isotype control CD69+ A.

Supplemental Figure 1. A. GCN1L1B. DSPC. RCN3 D. AKR1B10E. PDIA4F. CTSB.

A B A Stat3:Stat3 Supershift  -ST3 Free probe BP1-102 (µM) Stat3:Stat3 % of Cont Supplementary Figures Fig. S1 -

Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC GGTGAAGATCACGTTTTT TurboGFP shRNA bottom strand AATTAAAAACGTGATCTTCACCGACAAGATCTCGAGATC.

Gene expression (fold-increase vs. untreated control) > 7-fold Insulin/Glucose axis-unrelated genes Insulin/Glucose axis-related genes a Supplemental Figure.

Meta-analysis of progesterone supplementation during timed artificial insemination programs in dairy cows R.S. Bisinotto, I.J. Lean, W.W. Thatcher, J.E.P.

Figure Molecular Biology of the Cell (© Garland Science 2008)

Figure 14-1 Molecular Biology of the Cell (© Garland Science 2008)

a c b S1. Lee et al., 2011 * RRT-binding PXDLS-binding NAD(H)-binding

Figure 6. Effect of Withaferin A (WA) treatment on leptin-induced signaling in breast cancer cells. A) Immunoblotting for pSTAT3 (Tyr705), total STAT3,

Progesterone receptor

Figure S1. qPCR analysis of the EMT markers ZEB2 and SNAI1 in Syndecan-1 and control siRNA transfected MDA-MB-231 and MCF-7 cells reveals no significant.

A B C D Figure S3: DiO6(3) staining of mitochondrial networks in primary prostate tumor organ cultures. (A) Epithelial.

Chapter 08 The T Cell Receptor: Proteins and Genes

a b c d Supplemental Figure S x108 IFU 2x108 IFU 28 28

Cell death following DNA damage occurs from cells arrested in G1 or at the G1/S boundary. Cell death following DNA damage occurs from cells arrested in.

Supplement 1 -Psen1 -Psen2 Dasatinib (100 nM) Hours Con

Figures & Tables from the textbook.

Induction of apoptosis by CDIP expression.

Red: stable co-clustering Blue: no co-clustering

Influenza A Virus Lures Autophagic Protein LC3 to Budding Sites

A. D. B. C. - ΔNP63α - β-Actin IMEC - SUM MDA-MB IMEC

Bortezomib 1nM PU.1 GAPDH KMS12PE U266 U937 Supplemental Figure S1.

Angiogenesis Inhibitors

Supplemental Information

Supplemental Figure S1 a b

1A 1B Supplementary Figure 1. Parp HT29 C-Parp Gapdh LoVo

RM 2 7 +RM 2 4 RM 7 3 +RM 1 6 RM 5 2 +RM 2 4 RM 1 3 +RM5 2.

GENESDEV/2009/125252_Wu_ Supplemental Fig1

a b MCF-7 TR2 MCF-7 TR2 (Fold change) MTT Assay , (Fold change)

Supplementary Figure S2

Triple‐negative breast cancer (TNBC) cells in human express a specific gene signature and their self‐renewal depends on canonical Wnt/β‐catenin signalling.A.Human.

a b c d * MCF7.vec MCF7 IP: HA HA IgG p110 p  p85WT p85S83μ

Supplemental figure 1B Indicated cell lines were incubated with venetoclax (VEN) in combination with ara-C or idarubicin (IDA), for 48h and viability assessed.

SUPPLEMENTAL TABLE 1. Cell cycle profiles of HeLa cells treated

a b AP-1 Sp1 Nuclear extract Competitor (100X) CDCA 50 µM + - M

Supplemental Figure 5 v A Idarubicin 100 nM Idarubicin 300 nM B C D

Supplemental Figure 1A Pt Pt Pre-treatment

Supplemental Figure 1 a b c d.

Supplemental Digital Content 2 – Figure 1

Paradigms for the Three Rs: DNA Replication, Recombination, and Repair

Supplemental Figure 1 ** ** *** * FTH FTL

Alignment Sensitivities

Supplemental Digital Content 3 – Figure 2

Supplemental Figure 1 Patient 2.

Figure Overview.

*** Series 3RS Version 1, ***

Copyright © 2013 Elsevier Inc. All rights reserved.

Reh cells, 24 hours c-Myc Ac-p53 b-actin

P. Ecimovic, D. Murray, P. Doran, J. McDonald, D. G. Lambert, D. J

Supplemental Figure 1A SMM Patient #1 MP-CTL % CD3+ CD8+ T Cells

Figure 8. Measurement of levels of apoptotic proteins

EN1-associated chromatin complexes in breast cancer cells.

Figure 5-1 Molecular Biology of the Cell (© Garland Science 2008)

I3C reduces the level of Cdc25A protein in breast cancer cells.

Presentation transcript:

Supplemental Figure S2: G2 arrest in MCF7-shPBK1 stable cell line 200 400 600 800 1000 FL2-A 50 100 150 # Cells MCF7-RS -DMSO singlet RMS %G1 %S %G2 %<G1 %>G2 0.8 41.6 29.5 13.1 9.47 6.5 200 400 600 800 1000 FL2-A 50 100 150 # Cells MCF7-shPBK1 -DMSO singlet RMS %G1 %S %G2 %<G1 %>G2 2.1 15.7 17.7 30.2 13.4 22.5 B 200 400 600 800 1000 FL2-A # Cells MCF7-RS -1 uM dox singlet RMS %G1 %S %G2 %<G1 %>G2 2.87 43.5 29.9 16.1 7.74 3.15 200 400 600 1000 FL2-A 100 300 # Cells singlet RMS %G1 %S %G2 %<G1 %>G2 3.43 31 13.5 36.3 10.4 9.73 MCF7-shPBK1 -1 uM dox Supplemental Figure S2: G2 arrest in MCF7-shPBK1 stable cell line .