extremophiles and spider webs: adventures in genomics

Slides:



Advertisements
Similar presentations
Summary of SILS Grading Practices April 28, 2010.
Advertisements

Gene Expression in Yeast Demitri Dedousis. Need increase understanding of gene expression of non- coding regions that control expression Understanding.
Central Dogma Information storage in biological molecules DNA RNA Protein transcription translation replication.
ICS 324 Students Marks and Grades
AND Mrs. Watson E-220.
Analysis Of Spring 09 Enrollment. Percent Enrolled / All Students Spring CSU Channel Islands.
8/15/2015Bioinformatics and Computational Biology Undergraduate Major 1 Iowa State University College of Liberal Arts and Sciences Bioinformatics & Computational.
College Comparison By Caitlin Flowers New York University vs. Pepperdine University General Info General Info Admissions Cost & Financial Aid Cost & Financial.
COMPARISON OF THE GRADES OF TED ANKARA COLLEGE IBDP GRADUATES WITH GLOBAL AVERAGES (2002)
My Career Plan By Maria Gomez. My Career Goal To become a computer software engineer To design software to meet customers’ needs 2.
Pano Papadatos Mona Leigh Guha Tamara Clegg Clinky the Robot: Preliminary Programming for Preschoolers 5/23/2013.
NSF Proposal Ideas CRCD. Enhancements to CIMEL Analyze exercises data from CSE12-15 students – Where an exercise had overall poor results, revise exercise.
Freshman Discovery Seminars. Discovery Seminars will engage freshmen in a highly interactive classroom experience with a small group of peers and a faculty.
G1 Setting Financial Goals “Take Charge of Your Finances” Advanced Level.
Follow-up for Super Test Day- 11 th & 12 th Grade Platte County High School ACT Results.
EXPLORE and PLAN College Readiness Benchmark Scores The EXPLORE and PLAN College Readiness Benchmark Scores are based on the ACT College Readiness Benchmark.
Prokaryotes and fundamentally different from eukaryotes p547-p549 (Chap28, Raven et al.,)
1 Gender and Computing Maria M. Klawe President Harvey Mudd College.
An Empirical Study of In-Class Labs on Student Learning of Linear Data Structures Sarah Heckman Teaching Associate Professor Department of Computer Science.
Bioinformatics Education at North Central College Caroline St.Clair Professor of Computer Science.
The Advanced Diploma HIGH SCHOOLCOLLEGE & CAREER.
Elementary Education In a Technology Age Gregory Gates Period 5.
Women in Computing Netiva Caftori Northeastern Illinois University 2004.
Who am I?. Web Page Dr. Joe Mior Rm. 221
Investigating Careers Webmaster / Chief Technical Officer.
Welcome to 10 th Grade Information Night! October 16, 2012.
College Search 10 th Grade Plan Test #3. Pre-Test 1.What is the average ACT score range for an Open Admissions College? 2.What is the average composite.
Lecture 23: November 30, 2011 Creative Ideas Enabled by Computer Science CS 104 – Fall 2011 Exploring Computer Science.
Mobile County Public Schools is the Largest System in Alabama.
Scripting in your I 3 U (or course) (Perl or Python or Ruby or …) Mark D. LeBlanc Wheaton College Norton, MA GCGGCGACCACCTTATATGGTTCAGCAGGCCAA GCCTTATAAAAAGGCGGGCGGCTTCGCGAGGAC.
Graduating to a Pay Gap AAUW analyzed earnings and student loan debt burden among a nationally representative sample of college students in 2009, one.
Sample Results National Middle Colleges. Drop Out Statistics The graph shows the overall dropout rates each year for Mott Middle/Early College beginning.
Fall Semester Class Selection 2016 – 2017 REGISTRATION INFORMATION SESSION 1.
Assessing the Efficacy of Whether a Graphing Activity in Which Students Connect Biological Concepts to Themselves in a Biology of Women Course Improves.
Welcome to Back to School Night!. A little about myself Honor Graduate of National Pedagogical University, Kiev, Ukraine – Master’s Degree in Mathematics.
Cohort Graduation Rate. Cohort Graduation Rate Trends by Ethnicity 2014 N Size
Welcome to Digital Literacy. Julie Thorngren Currently teach at Snowcrest Jr High Have taught at: o Ogden High School o Stevens-Henager College o Roosevelt.
CHEMICAL COMPOUNDS IN CELLS By: Angelica Schwartz.
G1 Setting Goals. © Family Economics & Financial Education – Revised April 2010 –Values, Needs vs. Wants, & Goal Setting Unit – Setting Financial.
© Oxford University Press How are the plates moving?
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint Lectures for Biology: Concepts and Connections, Fifth Edition – Campbell,
Zoo Aaron Lougheed Graduated Sault Area High School ‘93 Graduated Ferris State University ’97 Teaching in Rochester Community Schools since ‘97.
Phylogeny and the Tree of Life
Report of Achieving the Dream Data Team
SLOs for Group/Team, School, BOCES Results
(7th) Chapter 7-4 Cornell Notes
Business analytics Lessons from an undergraduate introductory course
Microbial Taxonomy Classification Systems Levels of Classification
Biological classification
Figure 1. Accumulated recoding covering 200 kb of the S
MA G.L. 71: §2 and §3 Required Subjects
the-world-sees-the-role-of-women/
Relational Schemas Classroom (building, room-number, capacity) Department (dept-name, building, budget) Course (course-id, title, dept-name, credits) Instructor.
Welcome Class of th to 8th Grade Course Selection Meeting
The Scope of Biology Chapter One.
قواعد الاختبارات التحصيلية
Undergraduate Retention
College in the Schools (CIS)
Mark Guzdial College of Computing/GVU Georgia Tech
Welcome Open House 2013.
Ann Marie’s E-Portfolio
Sample Results National Middle Colleges
Test. essai.
a key to unlocking your future potential
Chapter Ten Evidence on the Sources of Gender Differences in Earnings and Occupations: Supply-Side Factors versus Labor Market Discrimination Francine.
Classification Review Flashcards
SAT School Day - April 12th
(CMS Graduates Attending CPCC from Fall )
Massachusetts Institute of Technology
My Plan for Success Student Name.
Presentation transcript:

extremophiles and spider webs: adventures in genomics Betsey Dexter Dyer Mark D. LeBlanc Wheaton College (Norton, MA)

.

Iteration of team-taught “DNA” course Percent women enrolled Percent of A grades [90-100] earned by women initial time 57% (N=14) 71% (5 of 7) second time 50% (N=10) 100% (3 of 3) (Fall 2007) 63% (N=16) Margolis and Fisher (2002) in “Unlocking the Clubhouse As a comparison, enrollment in computer science courses at Wheaton average about 10-20% women.

.

research

research teaching

You have some creative questions … You like tinkering … You (like an old-time explorer) are adventurous … .

methods (in silico) (0) wget_bash/wget -r -nv --accept "*.ptt,*.fna" -P genome_data "ftp://ftp.ncbi.nih.gov/genomes/Bacteria/" my $add_org_sql = "INSERT INTO organisms (genus, species, strain, ncbi_directory) VALUES (?,?,?,?)"; (2) $motifCounts{$nextMotif }++; (3) fit4 <- rpart(tempHyper ~ . , data=newpct4mer, method="class",control=rpart.control)

.

play

.

… … … … …

.

.

. . .

References Chargaff, E. 1963. Essays on Nucleic Acids. Elsevier, New York, NY. Dyer, B.D., Kahn, M.J., and LeBlanc, M.D. (2007). Classification and Regression Tree (CART) analyses of genomic signatures reveal sets of tetramers that discriminate temperature optima of Archaea and Bacteria. Archaea, v2(3). LeBlanc, M.D. and Dyer, B.D. (2007). Perl for Exploring DNA. Oxford University Press. Paydarfar, D. and Schwartz, W.J. (2001). Science 6 April 2001:
Vol. 292. no. 5514, p. 13.