3.5 Transcription and Translation Page 68 in your book

Central Dogma of Biology DNA  RNA (mRNA specifically)  protein DNA is the “control center” More specifically, DNA has control over protein synthesis

So, what’s the point? There are a lot of different proteins that help YOU function Enzymes Antibodies Hormones (some) Cell membrane proteins

Proteins Synthesis is Controlled by 2 sets of reactions Transcription Translation Both produce or require RNA

Quick Review: Compare DNA & RNA Contains 5 carbon sugar 5 carbon sugar is deoxyribose 5 carbon sugar is ribose Each nucleotide has 1 of 4 nitrogenous bases Bases: adenine, thymine, cytosine, guanine Bases: adenine, uracil, cytosine, guanine Double stranded Single stranded

Examiners Note The command term “compare” requires both similarities and differences You may give your answer in a table

Transcription produces RNA The sections of DNA that code for polypeptides are called genes Any 1 gene is a specific sequence of bases found in a specific location in a DNA molecule DNA is found in the nucleus Yet, proteins are made in ribosomes (located in the cytoplasm) So, there must be an intermediary molecule to carry the message of DNA to the cytoplasm This is RNA

Transcription Process Begins when an area of DNA becomes “unzipped” Only the location where the gene is found is unzipped The 2 complementary strands are now single stranded Only 1 strand is used as a template to create mRNA Enzyme = RNA polymerase Page 70 in book (figure 3.15)

Transcription process RNA nucleotides float into place by complementary base pairing A & U; C & G Facts to consider: Transcription occurs in the nucleus Only 1 strand of the DNA is used as a template mRNA is always single stranded; shorter than the DNA No thymine in RNA Uracil in RNA

Transcription Animation http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html

Exit Slip Proper heading; Title = Transcription Exit Slip 1. Compare the structure of DNA and RNA (three comparisons) 2. Where does transcription occur? 3. If a DNA strand reads: ATCGCCATAGGC, what would the transcribed strand of mRNA read?

The genetic code is written in triplets The message written into the mRNA molecule determines the order of amino acids Remember, amino acids covalently bonded  polypeptide The genetic code is written in 3 bases Every 3 bases is enough information to code for 1 of the 20 amino acids 3 bases = codon There are 64 possible combinations of 3 base triplets 3 of the 64 signal stop

3 types of RNA mRNA rRNA tRNA mRNA is a complementary copy of a DNA gene; codes for a single polypeptide rRNA Ribosomal RNA Each ribosome is composed of rRNA and protein tRNA Transfer RNA Each tRNA transfers 1 of the 20 amino acids to the ribosome for polypeptide formation Page 71 figure 3.16

Translation results in a polypeptide Once mRNA is transcribed, the mRNA detaches from the DNA DNA closes back up; no changes to DNA Floats out of nucleus through a pore and into the cytoplasm The mRNA will then locate a ribosome

Translation process A specific tRNA molecule now floats in Page 73 figure 3.17 in book Its tRNA anti codon must be complementary to the first codon triplet of the mRNA molecule Each tRNA brings an amino acid The amino acids are held together by peptide bonds (this is a condensation reaction)

Translation process The bond between the tRNA and amino acid is broken The tRNA floats away; reloads with another amino acid of the same type The process continues until a stop codon is reached The entire polypeptide breaks away; free floating in the cytoplasm

Translation Animations http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html Transcribe and translate a gene – good practice http://learn.genetics.utah.edu/content/begin/dna/transcribe/

Exercises #15, 16 page 74 See next slide for an mRNA codon chart

Answers 15) A. methionine – proline – arginine – threonine – phenylalanine – proline – serine – proline – glycine B. TACGGGGCGTGCAAAGGTTCGGGGCCC C. methionine – serine – arginine – threonine – phenylalanine – proline – serine – proline – glycine (note only the 2nd amino acid has been changed)

Answers 16. A substitution will change only a single triplet and thus can change the identity of only one amino acid within a polypeptide. A deletion shifts the groupings of bases by one base. This means that the triplets are all changed and therefore many amino acids will be altered within the polypeptide.