PCR of Chloroplast DNA

Aims Explore process of PCR: theory / practical Applications of PCR Investigate evolutionary relationships of plants Curriculum links

PCR Polymerase Chain Reaction (PCR) Allows selective amplification of any fragment of DNA providing the nucleotide sequences flanking the fragment are known Finds a needle in the haystack and then produces a haystack of needles by selective amplification Kary Mullis: Nobel Prize for Chemistry 1993

PCR

Plant PCR The use of amplified chloroplast DNA (cpDNA) to investigate evolutionary relationships of common plants

Plant PCR 1998: Flowering plants re-classified according to similarities in DNA Angiosperm Phylogeny Group Genes for rubisco - encoded in chloroplast DNA

Plant PCR Kenny Hamilton, Biology teacher, RSE Teaching Fellowship Royal Society of Edinburgh, Scottish Executive Kenny Hamilton, Biology teacher, RSE Teaching Fellowship Science and Plants for Schools Dr Craig Simpson - Scottish Crop Research Institute Dr Jan Barfoot - Scottish Institute for Biotechnology Education University of Edinburgh

Journal of Biological Education, 40

Plant PCR Summary of the procedure Diagram: Dean Madden, NCBE

Schedule for today Transfer of energy via ATP: meeting room Plant PCR (1): Extraction of DNA from plant material Pour gel Transfer of energy via ATP: meeting room Plant PCR (2): Purification of DNA from plant material Plant PCR (3): Amplification of cpDNA Immunity and Stem Cells: meeting room Plant PCR (4): Gel electrophoresis of amplified products Stain gels Results, discussion

Plant PCR – Session 1 Diagram: Dean Madden, NCBE

(i) Extraction of DNA Traditional method Mechanical breakdown of cell walls/membranes by homogenisation with sand Chemical disruption of cellular membranes by addition of detergent (SDS) EDTA chelates Mg++ ions, helps break up protein complexes NaCl helps disrupt cells and precipitate DNA Tris buffer maintains appropriate pH Ethanol to precipitate DNA

(i) Extraction of DNA FTA Cards – technology for processing nucleic acids invented by Professor Leigh Burgoyne of Flinders University Flinders Technology Australia, Fast Track Analysis Commercially obtained from Whatmans –contain SDS, TrisEDTA buffer and other proprietary reagents Application in research, diagnostics, environmental science, forensics and DNA databases Included in SAPS/NCBE PCR kit

Plant PCR (i) Extraction of DNA from plant material FTA card – chemically treated paper matrix for the safe collection, transport, storage, purification and analysis of DNA. DNA is extracted on to the paper matrix, purified and then amplified.

Plant PCR per 8 people Four FTA card Four backing boards Four different plant materials (2 Brassicas, 2 non-Brassicas) Four pestles Four punches per 8 people

Plant PCR Place backing board between the back cover of the card and the absorbent layer.

Plant PCR Place a piece of fresh plant material on to one box on the FTA card. Ensure it does not extend outwith the box. Close cover.

Plant PCR Using a pestle, squash the leaf on to the card until moisture has soaked through to the back of the absorbent layer. Discard squashed plant material. Try to keep the sample within the box.

Plant PCR Make sure that moisture from the leaf has soaked through to the back of the paper.

Plant PCR Have you labelled your samples?

Plant PCR Leave cards open to dry.

Frosted panel on this side Molten agarose 55–60 °C Diagram: Dean Madden, NCBE

Meeting Room - Transfer of energy via ATP - 11:15 - 12:30

DNA within the chloroplast Stroma Outer membrane Inner membrane DNA within the chloroplast Stroma Starch granule Stroma lamellae Lipid globule Granum Diagram: Dean Madden, NCBE

Plant PCR Chloroplast DNA Self-replicating DNA, 120 – 220 kb pairs Highly conserved gene order Contains genes that encode for tRNA (highly conserved across species)  nucleotide sequences identical in the chloroplast DNA of almost all higher plants ‘consensus’ or ‘universal’ oligonucleotide primers

Plant PCR Chloroplast DNA higher frequency of mutations in non-coding stretches of cpDNA which lie between genes  relatively high rates of evolutionary change amplification of non-coding regions of DNA between genes may be used to show differences in the cpDNA of different populations

Amplification of DNA Three stages in amplification process (1) Denaturation – by heating to 94°C - 98° C

Amplification of DNA Three stages in amplification process (2) Annealing – of synthetic oligonucleotide primers to end of area to be copied at 64° C primers Taq polymerase

Amplification of DNA Three stages in amplification process (3) Extension – of the strand by DNA polymerase from Thermus aquaticus at 72°C These three steps are repeated many times, the quantity of DNA doubling with each cycle

Primers anneal to complementary sequences of bases Primers Taq polymerase Non-target DNA Target DNA 50–65°C Primers anneal to complementary sequences of bases Primers 72°C Taq DNA polymerase extends the DNA strands 94°C Double-stranded DNA is denatured Diagram: Dean Madden, NCBE

Cycle 1 Cycle 2 Cycle 3 5| 3|

Plant PCR Diagram: Dean Madden, NCBE

Plant PCR Soft rubber tubing HOLD HERE Do not touch the point! 100 µL Yellow graduated tip Measure to the top of each band 50 µL 20 µL 10 µL Diagram: Dean Madden, NCBE

Plant PCR Microsyringe HOLD HERE Do not touch the tip! Graduated tip Do not touch the point! Graduated tip Graduated tip 10 μL 10 µL 2 μL 2 µL Diagram: Dean Madden, NCBE

(ii) Purification of DNA Purification buffer Commercial preparation, composition unknown but possibly contains SDS, Tris EDTA buffer Removes naturally occurring agents that would inhibit the PCR. For example, compounds that contain heavy metals such as chlorophyll, and other proteins TE-1 buffer (10 mM TrisHCl,0.1 mM Na2EDTA pH 8) Removes SDS Ensures correct pH

Plant PCR (ii) Purification of the extracted DNA Use the punch in turn (cleaning between samples) so that each individual removes one disc – the DNA to be amplified is on the disc. One Brassica and one non-Brassica per pair. One of each sample or one of three samples + negative control (blank paper, one per card) per four people. 4 completed cards (4 samples), 4 punches per 8 people

Plant PCR 1. Place cutting/backing board (clean!) behind absorbent layer. Place tip of the punch over the area to be sampled, press firmly and rotate to remove a paper disc. Important – choose an area where the extract has soaked through to the back. Clean punch between samples by removing a disc of paper from an extract-free area.

Plant PCR 2. Use a cocktail stick/ plastic ‘wire’ to transfer the disc from the punch into a labelled, clear 1.5 cm3 microcentrifuge tube. Use a different cocktail stick / ‘wire’ for each sample! Label sample!

Plant PCR 6. Repeat steps 3, 4 and 5 3. Add 100 l Purification Reagent to the disc. Different tips for different discs! 4. Close tube and flick tube to wash the disc. Ensure the disc remains in the liquid. 5. Remove and discard purification reagent. 6. Repeat steps 3, 4 and 5

Plant PCR 10. Repeat steps 7, 8 and 9 7. Use a fresh tip to add 100 l TE-1 buffer to the disc. Different tips for different discs! 8. Close tube and flick tube to wash the disc. Ensure the disc remains in the liquid. 9. Remove and discard buffer. 10. Repeat steps 7, 8 and 9

Plant PCR Summary of the procedure Diagram: Dean Madden, NCBE

Plant PCR -amplification PCR Beads: each bead is designed for a single 25 l reaction, in which volume the final component concentrations are: Taq polymerase ~2.5 units dNTPs (dATP, dCTP, dGTP, dTTP) 0.2 mM each TrisHCl (pH 9.0) 20 mM KCl 50 mM MgCl2 1.5 mM PCR Primers CHc primer (forward) CHd primer (reverse) Primers are diluted to a working concentration of 10 pmol/ l

Plant PCR Amplification of chloroplast DNA oligonucleotide primer 5’ 3’ oligonucleotide primer highly conserved region of cpDNA variable (non-coding) region of cpDNA CHc: 5’CGAAATCGGTAGACGCTACG3’ CHd: 5’GGGGATAGAGGGACTTGAAC3’ Primers

Plant PCR (iii) Amplification of cpDNA 1. Label PCR tube PCR beads contain Taq poymerase, dNTPs, buffers, co-factors 2. Add reagents 4 l sterile deionised water 10 l CHc primer 10 l CHd primer

Plant PCR 3,4 Close PCR tube, flick – centrifuge if necessary. 5. Use clean forceps to transfer the disc from microtube to PCR tube. Ensure disc is submerged in the PCR reagents. 6.Close tube.

Plant PCR 8. Place in thermal cycler.

Repeat this three-step cycle 30 times 30 seconds 30 seconds 30 seconds Repeat this three-step cycle 30 times Diagram: Dean Madden, NCBE

Plant PCR PCR cycle 94°C for two minutes to ensure maximum separation of the strands Thirty cycles of: 94°C for 30 seconds 55°C for 30 seconds 72°C for 30 seconds (at final stage 2 minutes) PCR product can now be refrigerated or frozen

Lunch Immunity and Stem Cells – meeting room

Plant PCR

Plant PCR Electrophoresis gel distance moved varies according to length of DNA fragments different sized fragments - distantly related? limitations

Plant PCR – session 3 Summary of the procedure Diagram: Dean Madden, NCBE

Plant PCR Pour 2–3 mm depth of buffer over the gel before you ease the comb out Diagram: Dean Madden, NCBE

Plant PCR (iv) Gel electrophoresis of PCR products – One gel tank per pair Diagram: Dean Madden NCBE 1. Add 2 l loading dye to 8 l DNA ladder (lilac microtube). Mix and load all 10 l into well 1 in a 1.5% agarose gel. Diagram: Dean Madden, NCBE

Plant PCR 2. Using a fresh tip, add 2 l loading dye to your amplified sample and mix well. 3. Load 10 l of the sample into a different well in the gel. Note sample/well! 4. Repeat step 3 for other PCR samples. Each gel tank should contain a ladder, two Brassicas, two non-Brassicas and one other or a negative control.

Plant PCR Diagram: Dean Madden NCBE Diagram: Dean Madden, NCBE

Place a comb over the tank to reduce evaporation Direction of DNA movement Direction of DNA movement Courtesy of Dean Madden

Plant PCR

Plant PCR Gel electrophoresis negatively charged DNA moves towards the anode gel is porous  small molecules travel through gel more easily than larger molecules  in a given time, smaller DNA fragments travel further than larger DNA molecules through a gel

Area with DNA bands Wells Loading dye Area with DNA bands Diagram: Dean Madden, NCBE

Tea / coffee – meeting room

Plant PCR – session 3 Summary of the procedure Diagram: Dean Madden, NCBE

Plant PCR - staining Positively-charged Azure A binds to the negatively-charged phosphate groups of the DNA DNA Diagram: Dean Madden, NCBE

Plant PCR - staining Stain on for 4 minutes!

DNA ‘ruler’ or ‘ladder’ Diagram: Dean Madden, NCBE

Plant PCR The distance moved on the gel by the amplified cpDNA varies according to its length. Bands which move the same distance but which are from different plants indicate that the lengths of DNA amplified are the same. This may indicate that these plants are genetically similar. To gain a more complete phylogenetic picture, many primer pairs would require to be used to provide comparisons over a greater range of the organisms’ DNA

SSERC Bulletin 233 Autumn 2010

Plant PCR PCR cycle 94°C for two minutes to ensure maximum separation of the strands 20 / 25 / 30 cycles of: 94°C for 30 seconds 55°C for 30 seconds 72°C for 30 seconds (at final stage 2 minutes)

Repeat this three-step cycle 30 times 30 seconds 30 seconds 30 seconds Repeat this three-step cycle 30 times Diagram: Dean Madden, NCBE

Plant PCR Summary of the procedure Diagram: Dean Madden, NCBE

Plant PCR Higher Biology Higher Human Biology Unit 1 Cell Biology d) Synthesis and release of proteins – the role of DNA, RNA and cellular organelles Unit 2 Genetics and Adaptation: Selection and speciation Unit 1, Cell function and inheritance b) protein synthesis: Role of DNA, RNA and cellular organelles Higher Human Biology

Plant PCR Higher Biotechnology Advanced Higher Biology Unit 1, Microbiology: b) 3. Copying and translating genes c) Genetic engineering Unit 3, Biotechnology: b) 2.Clinical and forensic medicine applications Cell and Molecular Biology: d) Applications of DNA Technology Advanced Higher Biology

Plant PCR Revised Higher Biology Revised Higher Human Biology Unit 1 DNA and the Genome 1 (b)(ii) Polymerase Chain Reaction (PCR) 1 (c) (i) Phylogenetics of molecular clocks Unit 1 Human Cells 2 (d)(ii) Amplification and detection of DNA sequences Revised Higher Human Biology

PCR CfE Higher Biology & CfE Higher Human Biology - common content The structure and replication of DNA Structure of DNA —….deoxyribose and phosphate at 3' and 5' ends of each strand. Organisation of DNA — …..Circular chromosome in mitochondria and chloroplasts of eukaryotes

Plant PCR Replication of DNA by DNA polymerase and primer. Polymerase chain reaction (PCR) amplification of DNA using complementary primers for specific target sequences. DNA heated to separate strands then cooled for primer binding. Heat-tolerant DNA polymerase then replicates the region of DNA. Repeated cycles of heating and cooling amplify this region of DNA.

Purpose of this practical work for students?