Electron Micrograph of a Neuron

Slides:



Advertisements
Similar presentations
Lesson 3: Translation.
Advertisements

Intracellular Compartments and Protein Sorting Haixu Tang School of Informatics.
Cell and Molecular Biology Behrouz Mahmoudi Cell Organelles-1 1.
Roadmap of protein traffic inside cell.
Post-Translational Events I Translocation of Newly Synthesized Proteins into Membranous Organelles.
2 Protein Targeting pathways Protein synthesis always begins on free ribosomes In cytoplasm 1) Post -translational: proteins of plastids, mitochondria,
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
Lecture 18: Intracellular transport Flint et al., Chapter 12.
Intracellular Compartments
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
Review For Final I. Should I take the final? Can’t hurt you Calculate your average and determine what you need to change your grade.
Endomembranes & Protein Trafficking Chapter 8 Part 1.
Gene Expression Overview
Inside of cell Interior of rough endoplasmic reticulum 5' Receptor protein Signal recognition particle mRNA Ribosome Signal sequence Protein synthesis.
Rough Endoplasmic Reticulum Lecture 19 BSCI 420/421Oct 16, 2002 “If you want the rainbow, you gotta put up with the rain” -Dolly Parton.
Topic 41 4.Structure/Function of the Organelles - Synthesis.
Lecture 6 - Intracellular compartments and transport I.
Lecture 7 - Intracellular compartments and transport II
A view of the eukaryotic cell: Elaborately compartmentalized systems *Generalized animal cell *Generalized plant cell.
Protein synthesis decodes the information in messenger RNA
ROUGH ENDOPLASMIC RETICULUM
Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.
1. Membrane Organization and the Plasma Membrane 1a. The lipid bilayer.
Cytology.
Histology Componente of cytoplasme. Content the following organeles and inclusion : Plasma membrane Mitochondria Ruogh endoplasmic reticulum Smooth endoplasmic.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting Proteins made in cytosol (cytosolic and.
MOLECULAR BIOLOGY – Protein synthesis PROTEIN SYNTHESIS.
Post-Translational Events II ER & Golgi Processes.
SYNTHESIS OF GLYCOPROTEINS
Last Class: 1. Posttranscription regulation
Protein Synthesis: Ch 17 From : Kevin Brown – University of Florida
Cytosol. The cytosol or intracellular fluid (or cytoplasmic matrix) is the liquid found inside cells. The cytosol is a complex mixture of substances dissolved.
8. Protein Synthesis and Protein Processing a). Ribosome structure b). Protein synthesis i). Initiation of protein synthesis ii). Peptide bond formation;
MOLECULAR CELL BIOLOGY SIXTH EDITION MOLECULAR CELL BIOLOGY SIXTH EDITION Copyright 2008 © W. H. Freeman and Company CHAPTER 13 Moving Proteins into Membranes.
Fates of Proteins in Cells See also pages in Goodman.
ER and Golgi: Working Together! Mr. Nichols PHHS.
Protein Synthesis. Translation Overview One codon One amino acid.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Chapter 12 Intracellular Compartments and Protein Sorting.
Copyright (c) by W. H. Freeman and Company 17.3 The rough ER is an extensive interconnected series of flattened sacs Figure
Getting things where they need to go: Protein Targeting Translation: Converting nucleotide sequence to amino acid chain Role of tRNA, base pairing and.
Biosynthesis of a Secretory Protein The starred words are made of membranes. This means that they are all composed of phospholipids Ribosome- *Rough Endoplasmic.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Protein targeting or Protein sorting Refer Page 1068 to 1074 Principles of Biochemistry by Lehninger & Page 663 Baltimore Mol Cell Biology.
The Signal Hypothesis and the Targeting of Nascent Polypeptides to the Secretory Pathway Tuesday 9/ Mike Mueckler
Post-Translational Events I Protein Trafficking
Biochemistry 2/e - Garrett & Grisham Copyright © 1999 by Harcourt Brace & Company.
Protein Localization Chapter Introduction Figure 10.1.
Intracellular Compartments and Protein Sorting
Protein Synthesis and Sorting: A Molecular View
The Nobel Prize in Physiology or Medicine 1999
Protein Sorting & Transport
Intracellular Vesicular Traffic
Fig
Intracellular Trafficking
Intracellular Vesicular Traffic
SUMMARY OVERVIEW OF PROTEIN SYNTHESIS
STRUCTURE AND FUNCTION OF CELLS
Protein Synthesis and Transport within the Cell
structure & function of eukaryotic organelle
1. What is this organelle?.
Figure6.1 Codon-anticodon interactions.
Protein Transport Molecular Cell
Intracellular Compartments and Transport
Termination of Translation
Translation B Sc III Mr. Maruti Hake Dept.of Botany
بسم الله الرحمن الرحيم.
Chapter 12 Intracellular Compartments and Protein Sorting
HOW DO LIPID SOLUBLE HORMONES WORK???
Presentation transcript:

Electron Micrograph of a Neuron

Electron Micrograph of a Neuron

3-Dimensional Reconstruction of the ER

Free and membrane–bound Ribosomes

A Typical Bacterial Signal Peptide

The Signal Peptide and the SRP Receptor

Protein Translocation of a Soluble Protein

Protein Translocation of a Single-pass Membrane Protein

Internal Signal Peptide Function

Mature Double-pass Membrane Protein

Insertion of the Multipass Membrane Protein Rhodopsin

Biosynthesis of Transport Vesiccles

The Dolichol

Glycosylation of a Protein

Synthesis of Dolichol Linked Oligosaccharide

Synthesis of Dolichol Linked Oligosaccharide - Continuation

Transport of Lysosomal Hydrolase

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com. Inc. All rights reserved.