Widespread AAA mutations in liver cancer: What are the implications? Steve Rozen and 黄伟添 (Alvin NG Wei Tian) steverozen@gmail.com Director, Centre for Computational Biology Professor of Cancer and Stem Cell Biology Associate Dean of Research Informatics Duke-NUS Medical School, Singapore Presentation at 昆山杜克大学 / Duke Kunshan University 2018 Sept 3

Duke-NUS Medical School Nonprofit partnership Duke in North Carolina, USA National University of Singapore (NUS) SingHealth, largest public healthcare provider, 3 hospitals, 3,100 beds 60 MDs / year 15 PhD students / year PhD program in biostatistics and bioinformatics: tinyurl.com/dnus-ibb http://kids.britannica.com/comptons/art-55105/Singapore

Outline Background: AAA compounds, herbs, nephrotoxicity Background: urothelial cancer and the AAA mutational signature Results: Widespread but variable AAA exposure in liver tumours Summary and important areas for future research

Outline Background: AAA compounds, herbs, nephrotoxicity Background: urothelial cancer and the AAA mutational signature Results: Widespread but variable AAA exposure in liver tumours Summary and important areas for future research

Aristolochic acids and analogues “AAA” Aristolochic acid IV (AAIV) Aristolochic acid I (AAI, intensively studied) Aristolochic acid II (AAII) AAI, AAII, AAIV in many 关木通， 广防己 Aristolactam I, proximal AAI mutagen in many 细辛, including roots/rhizome Aristolactam-N-beta-D-glycoside in some关木通 Ariskanin A in some 关木通） Aristolochic acids (AAI – most studied, also AAII, AAIV, in many 关木通)

Many herbal medicine traditions use AAA containing plants

Many herbal medicine traditions use AAA containing plants Romania India Brazil

Adenine > Thymine mutations Aristolochic acids metabolize to N-hydroxy-aristolactams and then acylnitrenium ions that form DNA adducts Covalent Bond to N6 Aristolactam Adenine Adenine DNA adducts lead to Adenine > Thymine mutations Figure from Arlt, Striborova, Schmeiser, 2002, Mutagenesis 17:265

AAAs are nephrotoxins 1891 Also: Orfila, 1851 Dumic, 1954, “Horse Poisoning by ‘Birthwort’ (Aristolochia clematitis L.)”

Kidney damage from AAAs Poon, 2013, doi:10.1126/scitranslmed.3006086 Nontreated versus AA-treated mouse kidney (hematoxylin and eosin staining, ×400; scale bars, 25 mm). At day 10, there was a dramatic accumulation of proteinaceous fluid within the tubules of the AA-treated kidney (*). At days 30 and 90, the tubular epithelial cells were necrotic and had collapsed, leaving the tubular basement membrane naked (#). There were few signs of regeneration. The glomeruli demonstrated ischemic shrinkage (arrowhead). At day 90, local inflammatory infiltration (arrow) was evident in the interstitium, and urothelial dysplasia had developed Jadot, 2017, doi:10.3390/ijms18020297 Evolution of structural abnormalities and collagen accumulation in experimental aristolochic acid nephropathy. Representative photographs of hemalun, Luxol fast blue and Periodic Acid Schiff stained kidney sections and Sirius Red stained kidney sections (400×) from CTL mice and mice intoxicated with AAI during four consecutive days. Necrotic tubules (+) with cell debris in tubular lumens; cystic tubules (triangles) Collagen I and III, highlighted by Sirius Red staining, accumulate in the interstitium of the kidney of AA-treated mice from Day 10 and even more at Day 20 reflecting the progression to CKD. Poon, 2013, doi:10.1126/scitranslmed.3006086 Also, review: 1st section of Dickman and Grollman 2010 10.1016/B978-0-12-801238-3.64093-X Jadot, 2017, doi:10.3390/ijms18020297

AAA and nephrotoxicity Reviewed in Jadot Int. J. Mol. Sci. 2017, doi:10.3390/ijms18020297 One large study (300 patients), Yang et al., 2011, Nephrol Dial Transplant (2012) 27: 292–298, doi: 10.1093/ndt/gfr291

Outline Background: AAA compounds, herbs, nephrotoxicity Background: urothelial cancer and the AAA mutational signature Results: Widespread but variable AAA exposure in liver tumours Summary and important areas for future research

AAA exposure often causes upper tract urothelial cancer (UTUC) First detected in the Belgian weight-loss clinic kidney failure victims (Nortier et al., 2000, NEJM 342:1686) Subsequently confirmed in multiple studies, eg Chen et al., Int. J. Cancer: 133, 14–21 (2013) UTUC was the cancer type in which we and others first were able to detect the AAA mutational signature

Slight digression: Technical basis for mutational signature analysis

MR Stratton et al. Nature 458, 719-724 (2009) doi:10.1038/nature07943 Cell divisions from the fertilized egg to a single cell within a cancer …. Somatic mutations are acquired by the cells over time Cell nucleus MR Stratton et al. Nature 458, 719-724 (2009) doi:10.1038/nature07943

Cell divisions from the fertilized egg to a single cell within a cancer …. Somatic mutations are acquired by the cells over time Cell nucleus Harmless mutations in the genome MR Stratton et al. Nature 458, 719-724 (2009) doi:10.1038/nature07943

Cell divisions from the fertilized egg to a single cell within a cancer …. Somatic mutations are acquired by the cells over time Cell nucleus Harmless mutations in the genome Oncogenic mutations and harmless “passenger” MR Stratton et al. Nature 458, 719-724 (2009) doi:10.1038/nature07943

Cell divisions from the fertilized egg to a single cell within a cancer …. Somatic mutations are acquired by the cells over time Cell nucleus Harmless mutations in the genome Oncogenic mutations and harmless “passenger” Multiple oncogenic mutations and harmless passenger mutations MR Stratton et al. Nature 458, 719-724 (2009) doi:10.1038/nature07943

Cell divisions from the fertilized egg to a single cell within a cancer …. Somatic mutations are acquired by the cells over time Cell nucleus Harmless mutations in the genome Oncogenic mutations and harmless “passenger” Multiple oncogenic mutations and harmless passenger mutations MR Stratton et al. Nature 458, 719-724 (2009) doi:10.1038/nature07943

We Identify cancer specific somatic mutations by large-scale sequencing (NGS) …ACGTCCTAGTCAAAATCGAGCC… …ACGTCCTAGTCTAAATCGAGCC…

We Identify cancer specific somatic mutations by large-scale sequencing (NGS) …ACGTCCTAGTCAAAATCGAGCC… …ACGTCCTAGTCTAAATCGAGCC… Somatic mutation from A > T (in a CAA trinucleotide context, so CAA > CTA)

This is the data for mutational signature analysis We look at all mutations (which are mostly passengers) We want to know: what is changing the DNA? ? We are not interested (for the moment) in how the changed DNA causes cancer

Cost per human genome (US $) Mutation signature analysis enabled by cheap next generation sequencing of cancer genomes $10 million In 2007 US $700 today 10,000 X drop in price http://www.genome.gov/sequencingcosts/ Cost per human genome (US $) Year

Mutagens in some herbs: AAA Aristolochic acid analogue Herbs Aristolochic acids and analogues AAA Covalent Bond to N6 Adenine Adenine is the chemical for the DNA letter A Adducts cause A to T mutations

Mutational signature in an AA-exposed UTUC (upper tract urothelial carcinoma) CAG>CTG TAG>TTG CAA>CTA Poon et al, Science Translational Medicine, 2013

Mutational signature in an AA-exposed UTUC (upper tract urothelial carcinoma) CAG>CTG TAG>TTG CAA>CTA Exposed cell line Poon et al, Science Translational Medicine, 2013

A few years ago (2013): AAA exposure in upper tract urothelial cancer and cells Exposed cells

A year ago: AA exposure in multiple tumor types Liver (China) Bile duct (China, Singapore) Kidney (Taiwan, Balkans) Upper Tract Urothelial (China, Belgium, Balkans) Bladder (China, Singapore) Poon et al., 2013 and subsequent data (liver - hepatocellular carcinoma [HCC]) Zou et al., 2015, Jusakul et al., 2017 (bile duct) Scelo et al., 2014, Jelakovic et al., 2014 (Kidney/RCC) Poon et al., 2013, Hoang et al., 2013, many others (UTUC) Poon et al., 2015, others (Bladder)

Evidence that this signature is due to AA and analogues Aristolochic acid signature in cell lines Mutational spectra of many tumours dominated by this signature (the signature is often easy detect by inspection) Signature associated with aristolactam adducts (kidney cancer, UTUC, intra- hepatic bile duct cancer) Associated with UTUCs in aristolochic acid kidney failure patients Associated with tumours in geographic regions with known high exposure to AAAs

Outline Background: AAA compounds, herbs, nephrotoxicity Background: urothelial cancer and the AAA mutational signature Results: Widespread but variable AAA exposure in liver tumours Summary and important areas for future research

Taiwan a known hotspot for AAA exposure, but AAA in liver cancer not previously studied there

78% of Taiwan liver cancers (HCCs) had the AA signature Ng, Poon, et al., Oct 2017 DOI: 10.1126/scitranslmed.aan6446

78% of Taiwan liver cancers (HCCs) had the AA signature Ng, Poon, et al., Oct 2017 DOI: 10.1126/scitranslmed.aan6446

78% of Taiwan liver cancers (HCCs) had the AA signature Ng, Poon, et al., Oct 2017 DOI: 10.1126/scitranslmed.aan6446

mSigAct signature presence test

mSigAct signature presence test

mSigAct signature presence test

mSigAct signature presence test

mSigAct signature presence test

Publicly available liver cancer mutation data from 1,400 HCCs We can ask: How extensive is AAA exposure in liver cancer across the world?

Widespread AAA mutations – Asia most affected (Mayo clinic mostly Asian patients) Ng, Poon, et al., Oct 2017 DOI: 10.1126/scitranslmed.aan6446

Widespread AAA mutations – Asia most affected (Mayo clinic mostly Asian patients) Ng, Poon, et al., Oct 2017 DOI: 10.1126/scitranslmed.aan6446

Number of AAA mutations was extremely variable North America No information Other SE Asia Other China Mayo Clinic Vietnam Taiwan Europe Korea Japan in tumours with the signature AAA signature mutations (mutations per megabase)

Number of affected known driver genes was extremely variable in tumours in known driver genes AAA signature mutations (counts) North America No information Other SE Asia Other China Mayo Clinic Vietnam Taiwan Europe Korea Japan

Outline Background: AAA compounds, herbs, nephrotoxicity Background: urothelial cancer and the AAA mutational signature Results: Widespread but variable AAA exposure in liver tumours Summary and important areas for future research

Main Points Liver mutation data indicate widespread exposure to AAAs AAAs are known urinary tract carcinogens and kidney toxins Prevalence of AAA-mutated HCCs varies by geographic location Number of AAA mutations in affected tumours varies by geographic location

Hypothesis: AAA exposure may elevate risk of liver cancer Evidence for: Chen et al., 2018 (International Journal of Cancer, doi: 10.1002/ijc.31544) Study of ~800,000 hepatitis-B-infected patients who visited TCM clinics; level of exposure estimated from prescription records Found linear relationship between dose and risk of HCC In our study (Ng et al, 2017) the proportion of exposed HCCs was 0.78 versus estimated 0.33 consuming AAA herbs (Hsieh, 2008) AAA mutations affected many known cancer driver genes Might be similar to aflatoxin, which interacts multiplicatively with hepatitis B infection to increase HCC risk

Important questions for future research Is AAA exposure a risk factor for HCC in isolation? In conjunction with hepatitis? Dose-risk relationship? Can non-invasive tests of AAA exposure be developed? Which AAAs have the main impact on kidney failure, urinary tract cancer, and (possibly) liver and bile duct cancers? Toxicodynamics? Effects of high dose for short period versus low dose for long period? How are people being exposed? Which herbs? How prepared? Which AAAs? Which aristolochic acids, aristolactams, and related compounds are in 细辛 roots? Stems and leaves? Which species? Regional differences within China? Exposure in Africa, Latin America?

Acknowledgements Chang Gung Memorial Hospital Sen-Yung Hsieh Hao-Yi Huang Ming-Chin Yu Po-Huang Lee Jacob See-Tong Pang Singapore (Duke NUS, National Cancer Centre Singapore, and Johns Hopkins Singapore) Song Ling Poon Mi Ni Huang Jing Quan LIM Arnoud Boot Willie Yu Yuka Suzuki Saranya Thangaraju Cedric C. Y. Ng Patrick Tan Ben Tean Teh Alex Chang Funding Singapore National Medical Research Council Singapore Ministry of Health via the Duke-NUS Signature Research Programmes Chang Gung Medical Foundation

Thank you Questions?