Quiz#4 LC710 11/14/11 name___________ Given the following full length cDNA for a highly expressed protein: 5’-ATCGATGCACTAGGGCCACCATGAGCAGCAACGGCGAGGACGCCGCCGAC AGCCACACCCCCGCCTGAAGAAGAAGCTGGAGAAGGAGTTCCACACGAAT CATTATCTGACCCGCAGACGGAGAATCGTTATGGCGCACGCGCTATGCCT GACGGAGCGGCAGATCAAGATCTGGTTCCAGAACCGGCGAATGAAGCTGA AGAAGGAGATCCAGTAAGCACACTAAGGCCAATAAACGTGGCCAGCAAGC ATTTAAAAAAAAAAAAAAAAAAAAAAAAAA-3’ This clone was identified from a Neanderthal cDNA library. Underline open reading frame (1pt) Translate open reading frame (2pts-single letter code) _____________________________ Does the sequence similarity make it more Gorilla or Human-like? (3pts) Is this clone likely to be a contaminate? (2pt) Yes or No (circle one)? Why or Why not? Extra Credit: On the sequence above Identify three salient features of this cDNA, other than Start and Stop codons (1pt) Genetic Code Probabilities for Gorilla (1) and Human (2). 1 2