Quiz#4 LC710 11/14/11 name___________

Slides:

Advertisements

Similar presentations

KEY WORDS – CELLS, DNA, INFORMATION All living things are made from Deoxyribonucleic acid is abbreviated This molecule stores that helps cells carry.

Advertisements

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Chapter 5: DNA, Gene Expression, and Biotechnology

Screening a Library Plate out library on nutrient agar in petri dishes. Up to 50,000 plaques or colonies per plate.

12-3 RNA and Protein Synthesis

Tutorial -1: BB 101 (30/7/13) Q.1: The language of life is coded into two sets of alphabets. The genetic information which is coded in the DNA is read.

Amino acids are coded by mRNA base sequences.

Asia Map Quiz Name: ______________________

Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.

The Genetic Code. The DNA that makes up the human genome can be subdivided into information bytes called genes. Each gene encodes a unique protein that.

The Genetic Code Objective: F2 - Explain … process of transcription & translation …, describe the role of DNA & RNA during protein synthesis, & recognize.

8.5 Translation KEY CONCEPT Translation converts an mRNA message into a polypeptide, or protein.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

An Introduction to Protein Synthesis

Ribosomes and Protein Synthesis

Quiz#3 LC710 9/29/10 name____________

Determine ORF and BLASTP

Name:_______________

BIOLOGY: DNA, RNA, TRANSCRIPTION, TRANSLATION, & MUTATIONS TEST REVIEW

Step 3 in Protein Synthesis

Gene Expression Continued

Amino acids are coded by mRNA base sequences.

Amino acids are coded by mRNA base sequences.

Amino acids are coded by mRNA base sequences.

Amino acids are coded by mRNA base sequences.

RNA and Protein Synthesis

RNA and Protein Synthesis

Protein Synthesis.

Quiz #5 (9%) Biol710 11/7/12 name___________

Quiz #7 (8%) Biol710 11/21/12 name___________

Quiz#3 LC710 10/17/12 name____________ Q1(4%)

Amino acids are coded by mRNA base sequences.

Quiz#6 LC710 10/13/10 name___________

Quiz #6 (8%) Biol710 11/19/12 name___________

Transfer of information from DNA

Protein Synthesis Translation.

Protein Synthesis Translation.

Amino acids are coded by mRNA base sequences.

Amino acids are coded by mRNA base sequences.

A: OAZ1 mRNA transcript of 775-1, and parental cell lines showing the stop codon introduced by the nonsense mutations in the and transcripts,

Section: ___ Time of lab:______8th or 9th floor (circle)

Biotechnology Project- Make your own GMO! GMO Advertisement

Proteins are made of amino acids

RNA DNA Synthesis Mutations Protein Synthesis

Quiz#2 LC710 10/15/12 name____________

Quiz#1 LC710 10/10/12 name____________

Quiz#6 LC710 10/13/10 name___________

Practice Clone 3 Download and get ready!.

Quiz#4 LC710 10/04/10 name___________

Amino acids are coded by mRNA base sequences.

RNA and Protein Synthesis

Amino acids are coded by mRNA base sequences.

Translation Decoding the message.

Quiz#1b LC710 11/05/17 name____________

Amino acids are coded by mRNA base sequences.

Quiz#1a LC710 11/05/17 name____________

Amino acids are coded by mRNA base sequences.

Where would you draw the polyA tail in the gene above?______________

Amino acids are coded by mRNA base sequences.

(1) It would stimulate mitotic cell division.

Continuation: translation

Translation converts an mRNA message into a polypeptide, or protein.

Amino acids are coded by mRNA base sequences.

Amino acids are coded by mRNA base sequences.

Amino acids are coded by mRNA base sequences.

Amino acids are coded by mRNA base sequences.

Amino acids are coded by mRNA base sequences.

Section 13.2 Protein Synthesis.

Nucleotide and predicted amino acid sequence of the adult mouse brain cdr2 cDNA. Nucleotide and predicted amino acid sequence of the adult mouse brain.

Presentation transcript:

Quiz#4 LC710 11/14/11 name___________ Given the following full length cDNA for a highly expressed protein: 5’-ATCGATGCACTAGGGCCACCATGAGCAGCAACGGCGAGGACGCCGCCGAC AGCCACACCCCCGCCTGAAGAAGAAGCTGGAGAAGGAGTTCCACACGAAT CATTATCTGACCCGCAGACGGAGAATCGTTATGGCGCACGCGCTATGCCT GACGGAGCGGCAGATCAAGATCTGGTTCCAGAACCGGCGAATGAAGCTGA AGAAGGAGATCCAGTAAGCACACTAAGGCCAATAAACGTGGCCAGCAAGC ATTTAAAAAAAAAAAAAAAAAAAAAAAAAA-3’ This clone was identified from a Neanderthal cDNA library. Underline open reading frame (1pt) Translate open reading frame (2pts-single letter code) _____________________________ Does the sequence similarity make it more Gorilla or Human-like? (3pts) Is this clone likely to be a contaminate? (2pt) Yes or No (circle one)? Why or Why not? Extra Credit: On the sequence above Identify three salient features of this cDNA, other than Start and Stop codons (1pt) Genetic Code Probabilities for Gorilla (1) and Human (2). 1 2