Electrophoresis A process used to separate DNA. DNA run through gel by an electric current. Negative charges of DNA molecule are attracted to the positive pole. Separated based on size, shape and charge. Smaller fragments move further through the gel.

Restriction Enzymes Restriction enzymes cut DNA at specific sequences. These enzymes are isolated from bacteria, where they serve as a defense against viral DNA. Restriction Enzyme Bacterial Source Restriction Site BamHI Bacillus amyloiquefacens H G G A T C C C C T A G G HindIII Hemophilus Influenzae Rd A A G C T T T T C G A A TaqI Thermus aquaticus T C G A A G C T

Uses of Restriction Enzymes in Biotechnology Restriction enzymes have several important uses in biotechnology. They are used to cut DNA for DNA fingerprinting. They are used to insert genes in genetic recombinant (such as a fish gene being added to a strawberry plant’s genome to create a strain that resists freezing.)

DNA Fingerprinting A method to distinguish between individuals based on their unique DNA patterns. DNA is cut into fragments with restriction enzymes. Number of fragments and fragment lengths vary for each person due to differing positions of restriction sites (sequences cut by restriction enzymes) in each person’s genetic code.

ATTCGGATCCATATATGGATCCCAAGCGCGC 3 Fragments If a restriction enzyme cuts the sequence GGATCC, determine how many fragments the following two DNA sequences will be cut into . ATTCGGATCCATATATGGATCCCAAGCGCGC 3 Fragments ATTCCCATCCATATATGGATCCCAAGCGCGC 2 Fragments

Who most likely killed Miss Scarlet? Which suspect most likely robbed the bank? Who most likely killed Miss Scarlet? Suspect #2 Mrs. White