Phenylthiocarbamide (PTC)

Slides:

Advertisements

Similar presentations

Structure of DNA. Polymerase Chain Reaction - PCR PCR amplifies DNA –Makes lots and lots of copies of a few copies of DNA –Can copy different lengths.

Advertisements

Polymerase Chain Reaction (PCR). PCR produces billions of copies of a specific piece of DNA from trace amounts of starting material. (i.e. blood, skin.

Bridges 2014 Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability.

Biotechniques. Magnification DNA samples are often too small for effective study 2 methods of multiplying DNA samplePCR Cloning vectors.

The polymerase chain reaction (PCR) rapidly

Polymerase chain reaction

WORKSHOP (1) Presented by: Afsaneh Bazgir Polymerase Chain Reaction

Polymerase Chain Reaction

PCR By Staci Cutting and Mitch Gavazzi. What is PCR? PCR is sometimes called Molecular photocopying the polymerase chain reaction is a fast and inexpensive.

EDVOKIT#300: Blue/White Cloning of a DNA Fragment

 It is the methods scientist use to study and manipulate DNA.  It made it possible for researchers to genetically alter organisms to give them more.

Recombinant DNA Technology………..

Single Nucleotide Polymorphisms Mrs. Stewart Medical Interventions Central Magnet School.

By: Kelly and Kathryn PCR. What exactly is PCR? PCR stands for “polymerase chain reaction” and is a lab technique used to clone segments of DNA. Two main.

Genetics Techniques: RFLP & PCR AP Biology Unit 3.

Polymerase Chain Reaction PCR. invented by Karry B. Mullis (1983, Nobel Prize 1993) patent sold by Cetus corp. to La Roche for $300 million depends on.

Polymerase Chain Reaction Mrs. Stewart Medical Interventions.

Polymerase Chain Reaction (PCR)

What do these terms mean to you? You have 5 min to discuss possible meanings and examples with your group! DNA sequencing DNA profiling/fingerprinting.

 It is the methods scientist use to study and manipulate DNA.  It made it possible for researchers to genetically alter organisms to give them more.

Qai Gordon and Maddy Marchetti. What is Polymerase Chain Reaction? Polymerase Chain Reaction ( PCR ) is a process that amplifies small pieces of DNA to.

Principle of PCR Principle of PCR Prof. Dr. Baron.

Polymerase Chain Reaction (PCR) Developed in 1983 by Kary Mullis Major breakthrough in Molecular Biology Allows for the amplification of specific DNA fragments.

Success criteria - PCR By the end of this lesson we will be able to: 1. The polymerase chain reaction (PCR) is a technique for the amplification ( making.

V IRAL Q UEST Lesson 8: Reverse Transcription. Reverse Transcription  Reverse Transcription converts RNA into complementary DNA.  This DNA strand can.

Polymerase Chain Reaction (PCR)

Nucleotides and Nucleic Acids. Cellular Processes DNA RNA (mRNA) Proteins LipidsCarbohydrates replication transcription translation.

Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability Lab Overview.

6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.

Polymerase Chain Reaction A process used to artificially multiply a chosen piece of genetic material. May also be known as DNA amplification. One strand.

Amplification of a DNA fragment by Polymerase Chain Reaction (PCR) Ms. Nadia Amara.

Polymerase Chain Reaction (PCR). PCRPCR PCR produces billions of copies of a specific piece of DNA from trace amounts of starting material. (i.e. blood,

PCR – Polymerase Chain Reaction A method of amplifying small amounts of DNA using the principles of DNA replication.

Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability Lab Overview.

Semiconservative DNA replication Each strand of DNA acts as a template for synthesis of a new strand Daughter DNA contains one parental and one newly synthesized.

Introduction to PCR Polymerase Chain Reaction

Copying DNA: The Polymerase Chain Reaction. The Polymerase Chain Reaction (PCR) POINT > Explain why copying DNA is useful POINT > Define PCR POINT > Describe.

Kevin Chen.  A method of amplifying or copying DNA fragments.

I. PCR- Polymerase Chain Reaction A. A method to amplify a specific piece of DNA. DNA polymerase adds complementary strand DNA heated to separate strands.

Presented by: Khadija Balubaid.  PCR (Polymerase Chain Reaction) is a molecular biological technique  used to amplify specific fragment of DNA in vitro.

Polymerase Chain Reaction

Success criteria - PCR By the end of this lesson we will be know:

PCR and Gel Electrophoresis

Polymerase Chain Reaction (PCR)

Gel electrophoresis analysis Automated DNA analyzer.

Nucleic acid-based methods (I)

Bio 211 d16 DNA!.

Molecular Cloning: Polymerase Chain Reaction

Principle of PCR Principle of PCR Prof. Dr. Baron.

Polymerase Chain Reaction

Intro to PCR PCR (polymerase chain reaction) was invented by Kary Mullis in Mullis as a chemist working on small nucleotide strands for a biotech.

PCR uses polymerases to copy DNA segments.

BIOTECHNOLOGY BIOTECHNOLOGY: Use of living systems and organisms to develop or make useful products GENETIC ENGINEERING: Process of manipulating genes.

Single Nucleotide Polymorphisms

3. PCR Page 376 – 377.

Lab 8: PTC Polymerase Chain Reaction Lab

Polymerase Chain Reaction (PCR) technique

Polymerase Chain Reaction

Nucleic acid-based methods (I)

PCR uses polymerases to copy DNA segments.

PCR uses polymerases to copy DNA segments.

Polymerase Chain Reaction (PCR).

Introduction to Polymerase Chain Reaction (PCR)

PCR Polymerase chain reaction (PCR)

PCR uses polymerases to copy DNA segments.

PCR uses polymerases to copy DNA segments.

PCR uses polymerases to copy DNA segments.

POLYMERASE CHAIN REACTION

Polymerase Chain Reaction (PCR) & DNA SEQUENCING

PCR uses polymerases to copy DNA segments.

Presentation transcript:

Phenylthiocarbamide (PTC) 70% can taste PTC Taste very bitter or tasteless 3 Single Nucleotide Polymorphisms (SNPs) in the TASR (tasting gene) Dominant Trait!! Heterozgygous can taste Homozygous have more intense taste response

PCR: The Basic Steps

Need a Special DNA Polymerase: Taq Isolated from thermophilic bacterium Thermus aquaticus found in Hot Springs in Yellowstone N. P. Can survive in high temperatures Polymerization occurs at high temperature

PCR Primers: You need a “Sense” Primer and an “Antisense” Primer TTGGACTGACAGTAGATTGATAGATGATATGATGATGCAGCTAGCTAATCGACAACCTGACTGTCATCTAACTATCTACTATACTACTACGTCGATCGATTAGCTG

Primers: Essential for Taq Polymerase Important that know the DNA sequence of your gene that you want to amplify TTGGACTGACAGTAG (sense) 5’TTGGACTGACAGTAGATTGATAGATGATATGATGATGCAGCTAGCTAATCGAC AACCTGACTGTCATCTAACTATCTACTATACTACTACGTCGATCGATTAGCTG 3’ (antisense)CGTCGATCGATTAGCTG

PCR allows exponential amplification of a very small of amount of DNA into large quantity

Steps of PCR: Overview Two single-stranded DNA produced by heat denaturing of dsDNA template Primers anneal (hybridize) to their complementary sequences containing the denatured ssDNA molecules Taq polymerase (or similar enzyme) replicates the ssDNA segments to which the primers have annealed Multiple rounds of amplification yield high amount of desired target sequence