RECALL… In our first unit (Biochemistry), we learned that there were 4 major organic compounds. Carbohydrates Lipids Proteins Nucleic Acids Nucleic Acids serve as the blueprint for proteins Gives organisms their unique traits like hair/eye color, blood type, height, skin color, etc. tschwartz

DNA= Code of Life tschwartz

(de – without, oxy – oxygen, ribo – ribose sugar) 2 Types of Nucleic Acids 1) DNA – deoxyriboNUCLEIC ACID (de – without, oxy – oxygen, ribo – ribose sugar) Store and pass genetic information Sex Cells (sperm & egg) are the ONLY cells that can pass genes/traits down to their offspring. Code for proteins 2) RNA – riboNUCLEIC ACID Protein synthesis Subunits of DNA/RNA: nucleotides tschwartz

Types of Nucleic Acids tschwartz

DNA Found in the nucleus of eukaryotes (in cytoplasm of prokaryotes) DNA nucleotides bond together to form a double helix Double stranded Helix = twisted ladder “Rungs” (steps of the ladder) are nitrogen bases “Sides” are the sugar-phosphate backbone tschwartz

Nucleotide Structure 3 parts of a NUCLEOTIDE: Sugar (deoxyribose or ribose) Phosphate (P with oxygens attached) 4 Nitrogen bases: Adenine (A) Thymine (T) Guanine (G) Cytosine (C) S P tschwartz

Nucleotide Structure Y like Thymine and Cytosine Adenine 2 classes of nucleotides determined by the base that attaches to the sugar. Purines Adenine Guanine Pyrimidines Thymine Cytosine Purines are PURE – like AnGels Pyrimidines – Y like Thymine and Cytosine tschwartz

CHARGRAFF’S Base Pairing Rule Scientists James Watson and Francis Crick showed that DNA shape is a double helix. A (adenine) hydrogen bonds with T (thymine) C (cytosine) hydrogen bonds with G (guanine) tschwartz

Nitrogen Base Pairing Adenine Thymine 4-eva Guanine Cytosine tschwartz

Adenine Thymine Guanine Cytosine Nitrogen Base Pairing Adenine Thymine Guanine Cytosine = Hydrogen Bond tschwartz

Nitrogen Base Pairing Adenine Thymine Cytosine Guanine Thymine Adenine Adenine Thymine Guanine Cytosine Sugar + Phosphate backbone tschwartz

Compl-e-ment – complement To complete, finish, or fill something up NOT this kind… Compl-i-ment - compliment “Miss Clark has great earrings on today!” tschwartz

What is the complementary DNA strand? EXAMPLE 1 3’ end 5’ end ATTGACCATTGATAGCCGAATA TAACTGGTAACTATCGGCTTAT EXAMPLE 2 5’ end 3’ end TCTTCGGAACATTAGTCGAGGC AGAAGCCTTGTAATCAGCTCCG tschwartz

In what phase of the cell cycle does DNA copy itself for the new cell? Q.Q. 11/27/18 In what phase of the cell cycle does DNA copy itself for the new cell?

Cell Cycle tschwartz

S phase of the Cell Cycle DNA Replication S phase of the Cell Cycle

DNA Replication DNA replication: Not only does DNA function as the code of life for protein synthesis, DNA also replicates to ensure that every new cell has identical DNA DNA replication: Copying of 1 molecule of DNA to make 2 identical molecules of DNA tschwartz

Steps in DNA Replication Occurs when chromosomes duplicate (make copies) An exact copy of the DNA is produced with the aid of enzymes, specifically helicase and DNA polymerase. Hydrogen bonds between bases break and helicase “unzips” the molecule (opens up the double helix!) tschwartz

Steps in DNA Replication continued… Each old strand of nucleotides serves as a template for each new strand New nucleotides move into complementary positions are joined by the enzyme DNA polymerase. Practice ANIMATION!

DNA Replication tschwartz

DNA Replication RESULT of DNA replication = 2 identical DNA molecules REMEMBER: each exposed base can only bond to its complementary base! Adenine (A) --- Thymine (T) Guanine (G) --- Cytosine (C) RESULT of DNA replication = 2 identical DNA molecules Each DNA molecule is made up of one NEW strand (daughter strand) and one OLD strand (parent strand) tschwartz

Try this… TAG ACC CAG CCC CCG CAC CTG TTA AAA Using the base pairing rules of replication, what is the complementary strand of DNA for the following examples: TAG ACC CAG CCC CCG CAC CTG TTA AAA tschwartz