Welcome to Jeopardy!
Final Jeopardy Round 1 Round 2
Which Came First? DNA vs. RNA Not Quite X Men Gene Switch T & T Biotech Round 1 $200 $200 $200 $200 $200 $200 Final Jeopardy $400 $400 $400 $400 $400 $400 Scores $600 $600 $600 $600 $600 $600 $800 $800 $800 $800 $800 $800 $1000 $1000 $1000 $1000 $1000 $1000
What sugar is found in a nucleotide of… $200 What sugar is found in a nucleotide of… DNA? RNA?
$200 DNA: deoxyribose RNA: ribose Scores
Contains specific sequences that code for proteins $400 Contains specific sequences that code for proteins
$400 DNA Scores
A terminator is a sequence of (DNA/RNA) that marks the end of a gene $600 A terminator is a sequence of (DNA/RNA) that marks the end of a gene
$600 DNA Scores
If a DNA sequence is TGA, what is the tRNA anticodon? $800 If a DNA sequence is TGA, what is the tRNA anticodon?
$800 UGA Scores
DNA sequence that will produce the mRNA codon of UGC $1000 DNA sequence that will produce the mRNA codon of UGC
$1000 ACG Scores
$200 Process during which RNA nucleotides are matched with complimentary DNA nucleotides
$200 Transcription Scores
Daily Double
Enzyme that links together RNA nucleotides to form RNA $400 Enzyme that links together RNA nucleotides to form RNA
$400 RNA Polymerase Scores
$600 Molecule that recognizes a codon in order to match the proper amino acid
$600 Transfer RNA Scores
$800 A protein made of 210 amino acids was coded by a mRNA of at least this many codons
$800 210 codons Scores
mRNA codon that will be created based on this DNA template $1000 5’ TAC 3’ mRNA codon that will be created based on this DNA template
$1000 5’ TAC 3’ 3’ AUG 5’ 5’ GUA 3’ Scores
$200 A mutation is caused by a change in the nucleotide sequence of (DNA/RNA)
$200 DNA Scores
Two examples of frameshift mutations $400 Two examples of frameshift mutations
$400 Insertion Deletion Scores
$600 Type of point mutation that changes every amino acid after the mutated nucleotide
$600 Frameshift mutation Scores
Type of mutation that has no effect on resulting protein $800 Type of mutation that has no effect on resulting protein
$800 silent Scores
$1000 Two types of mutations that may result in an amino acid change only at the mutation point
$1000 Missense Nonsense Scores
Why eukaryotic body cells composed of the same genes can be so diverse $200 Why eukaryotic body cells composed of the same genes can be so diverse
Different genes turned on/off in different cells $200 Different genes turned on/off in different cells Scores
Process that allows 30,000 genes code for 100,000 proteins $400 Process that allows 30,000 genes code for 100,000 proteins
$400 Alternate splicing Scores
Daily Double
$600 Component of prokaryotic genes that allow them to adapt to the changing environment
$600 Operon Scores
$800 Based on this diagram, there are (high/low) levels of tryptophan present in the environment
$800 Low The operon is not blocked, so tryptophan can be produced from this gene. Tryptophan will be made until there is enough, or too much, in the environment. Scores
In this diagram, the operon is turned (on/off). Explain. $1000 In this diagram, the operon is turned (on/off). Explain.
$1000 Off! The co-repressor (tryptophan) is bound to repressor, giving the repressor the correct shape to bind with the operon and block RNA polymerase Scores
$200 DNA created by combining DNA fragments from organisms of different species.
$200 Recombinant DNA Scores
End of a DNA fragment that contains single-stranded nucleotides $400 End of a DNA fragment that contains single-stranded nucleotides
$400 Sticky end Scores
$600 Bonds that sticky ends will form with complementary sticky ends to form recombinant DNA
$600 Hydrogen bonds Scores
$800 How many restriction sites? How many fragments? Bcl I T↓GATCA 5’ TTTGATCAAACCGGTGATCATGCCCTTAA 3’ 3’ AAACTAGTTTGGCCACTAGTACGGGAATT 5’ How many restriction sites? How many fragments?
$800 5’ TTT↓GATCAAACCGGT↓GATCATGCCCTTAA 3’ 3’ AAACTAG↓TTTGGCCACTAG↓TACGGGAATT 5’ 2 restriction sites 3 fragments Scores
$1000 Create a gel electrophoresis based on the above DNA 5’ TTT↓GATCAAACCGGT↓GATCATGCCCTTAA 3’ 3’ AAACTAG↓TTTGGCCACTAG↓TACGGGAATT 5’ Create a gel electrophoresis based on the above DNA 10 8 5 2
$1000 Scores
RNA Polymerase binds to DNA $200 Which came first? RNA Polymerase binds to DNA or DNA unwinds
$200 DNA unwinds Scores
Anticodon binds to codon Amino acid binds to growing protein chain $400 Which came first? Anticodon binds to codon Or Amino acid binds to growing protein chain
Anticodon binds to codon $400 Anticodon binds to codon Scores
mRNA binds with ribosome Or $600 Which came first? mRNA binds with ribosome Or Introns are removed and exons are spliced together
Introns are removed and exons are spliced together $600 Introns are removed and exons are spliced together Scores
$800 Which came first? Terminator Or Stop codon
$800 terminator Scores
$1000 Which came first? DNA ligase Or Restriction enzyme
$1000 Restriction enzyme Scores
Final Jeopary Question Jeopardy Final Jeopary Question Scores
Scores