Mutations Section 12-4.

Slides:

Advertisements

Similar presentations

Human Genetic Mutations

Advertisements

Section 11.3 MUTATIONS Section 11.3 pgs

Mutations And their effects. A mutation is…  A permanent change that occurs in a cell’s DNA.

Mutations Chapter 12.4.

Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.

MUTATIONS Honors Biology Section 11.6 & Biology Section 8.7 Revised 2011.

Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.

12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

Gene Regulation and Mutation Notes and Questions How do mutations affect a cell?

1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Gene Regulation and Mutation Notes and Questions How do mutations affect a cell?

MUTATIONS No this can’t happen with just mutations.

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

Human Genetic Mutations

12.4 Assessment Answers.

Mutations and Nature vs. Nurture.

Gene Mutations.

Lecture 55 Mutations Ozgur Unal

Mutations (12.4) State Standard

A mutation is a change in an organism’s DNA.

Types of Mutations.

Copyright Pearson Prentice Hall

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Genetic Mutations.

Human Genetic Mutations

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

11.3 Section Objectives – page 296

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Some mutations affect a single gene, while others affect an entire chromosome.

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Distinguish between codon and anticodon.

A mutation is a change in an organism’s DNA.

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutation Notes.

Copyright Pearson Prentice Hall

A mutation is a change in an organism’s DNA.

Section 20.4 Mutations and Genetic Variation

A mutation is a change in an organism’s DNA.

Unit 1 Human Cells Higher Human Biology for CfE Miss Aitken

Protein Synthesis and Mutation

DNA Mutations Types & their effects.

Presentation transcript:

Mutations Section 12-4

What is a mutation? Mutations are permanent changes in a cell’s DNA. There are 2 categories of mutations: Point mutations – involve one nucleotide Chromosomal mutations – involve the chromosome

Types of Point Mutations Substitution One base is exchanged for another (A in place of G, for example) Most of the time is a missense mutation, where the DNA code is altered, leading to the wrong amino acid Occasionally it is a nonsense mutation, where a codon for an amino acid is changed to a STOP codon.

What happens if a Stop codon occurs in the wrong place? When a Stop codon is reached, the ribosome stops translating… Therefore the protein stops growing… If the protein is not finished, it will not work properly Will this car run properly?

Is it possible to have a substitution mutation and not be aware of it? Yes. For example, CCU, CCC, CCA, & CCG all code for proline. If there was a substitution in the last nitrogenous base of the codon, the amino acid (and therefore the protein) would be unchanged.

Other types of mutations Insertions – A nucleotide is added Deletion – A nucleotide is removed These are called frameshift mutations because they change the “frame” of the amino acid sequence. Duplications and expanding mutations involve repeated codons.

Results of Mutations Most of these mutations result in genetic disorders. Why? The order of amino acids relates to the way the protein folds & to its stability. The way the protein folds relates to the protein’s function. Diseases caused by incorrect protein folding include sickle cell disease, Alzheimer’s disease, cystic fibrosis, diabetes, and cancer.

What causes mutations? Some mutations occur spontaneously. Others are caused by mutagens, which can alter the chemical structure of the bases and allows them to pair incorrectly. Examples of mutagens are X rays, UV radiation, etc.

Body cell vs. Sex cell mutations Body cells are not passed on to offspring, so mutations in your body cells affect YOU, but not your children. Mutations in the sex cells are passed on to your CHILDREN because they start out as one cell that contains the mutated DNA.

Is it possible for mutations to be good? Yes. Mutations increase genetic variation. Sometimes mutations provide something beneficial (more dense bones, for example) This is how evolution starts.