The acetyl-CoA synthase/carbon monoxide dehydrogenase (Acs) operon gene organization of unFirm_1 and comparisons with sequenced acetogen genomes (a) and.

Slides:

Advertisements

Similar presentations

Functional Annotation of Formerly “Unculturable” SAR11 Bacteria Jim Tripp, JGI Stanford Research Institute March 4, 2013.

Advertisements

NUCLEIC ACIDS {DNA;RNA} w 1. What are they? w 2. Where are they found? w 3. What are their functions? w 4. What is a nucleotide? Draw one. w (pages 219.

Biological Synthesis of “Fatty” Acids. Enzyme = ‘fatty acid synthase” (multifunctional enzyme) Condensing Enzyme (CE) Acyl Carrier Protein (ACP)

Coenzymes and Vitamins

Chorismate is an important precursor for aromatic amino acids Derived from PEP and erythrose 4- phosphate First branch point of pathways, one leading to.

Metabolism and Energy Production

Energy Def: the capacity to do work 2 kinds –Kinetic Energy of motion –Potential Stored energy.

ATGGCAAAAGATCGTCGCAGTAATGAAGCTGAAAATATCGCTGTTGTTGAAAAACCGCTGAAATCGGACCG CTTCTTTA TCTCTGATGGTCTGCCGAGTCCGTTCGGCCCGACCGTTCGTGATGACGGTGTGAATTTTTCTGTTTATAGT.

Metagenome Analysis: a case study Analysis of a thermophilic terephthalate-degrading syntrophic community Thanos Lykidis.

Table S4. Summary of proteins identified by MALDI-TOF-MS Spot no.* Average Ratio** NCBI accesion no. Gene nameProtein name Theoretical pI/MW SCORE Sequence.

The Genetic Code. The DNA that makes up the human genome can be subdivided into information bytes called genes. Each gene encodes a unique protein that.

More about proteins Proteins are the building block of our bodies. They make up many components (muscle, skin) or direct the synthesis of components (bone,

Bacillus Phage Annotation Phage Lab II, Spring 2015.

454 Genome Sequence Assembly and Analysis HC70AL S Brandon Le & Min Chen.

Functions Enzymes – organic catalysts Structural – skin, hair, muscle Antibodies Hormones.

Ch 6 Cellular Respiration.

Reads aligned into contigs

Down Syndrome: Genes, Model Systems, and Progress towards Pharmacotherapies and Clinical Trials for Cognitive Deficits Cytogenet Genome Res 2013;141:

Yuvaniyama et al., 2003, Nature Structural Biology

Clostridial fermentations

Clostridial fermentations

Effects on the content of mtDNA and the expression of the OXPHOS genes by deletion of SHMT2 in 293A cells. Effects on the content of mtDNA and the expression.

Supplemental Figure S1. Alignment of drimenol synthase amino acid sequences from P. hydropiper and V. officinalis. Amino acid sequences were aligned with.

Biological Molecules -Biological molecules consist primarily of carbon, oxygen, hydrogen, and nitrogen. -These elements share valence electrons to form.

Identify D. melanogaster ortholog

Bacterial genomics: The controlled chaos of shifty pathogens

Distribution of the known and new candidate genes involved in hydroxylation reactions of UQ biosynthesis in proteobacteria. Distribution of the known and.

Relationship between Genotype and Phenotype

The dicBF locus is conserved in E. coli species in different prophages

Epigenetics Heritable alteration of gene expression without a change in nucleotide sequence.

Essential Question: How cells make proteins

Phenotype phase planes of light and phosphate uptake for key photosynthetic fluxes. Phenotype phase planes of light and phosphate uptake for key photosynthetic.

The Origin of Membrane Bioenergetics

Alignment of H-NS, H-NS2, and StpA amino acid sequences.

Fractions of 16S rRNA genes from bacteria (top panel) and archaea (bottom panel) in public databases from primer-amplified metagenomes (with and without.

(A) Structures of mandelalides A to D

Metabolic pathway changes of intracellular M. tuberculosis.

Evidence of horizontal gene transfer between amoeba and bacteria

Golden Gate assembly of transposon delivery vectors from part vectors.

Correlation of mouse gene expression with bacterial gene expression.

Allosteric site of B. subtilis PRPP synthase.

Pathways of methanogenesis.

Electron Transport Phosphorylation: 32 ATP Glycolysis: 2 ATP Krebs Cycle: 2 ATP Electron Transport Phosphorylation: 32 ATP Each.

Example usage of mockrobiota MC resource for marker gene and metagenome sequencing pipelines. Example usage of mockrobiota MC resource for marker gene.

Maximum likelihood (ML) unrooted tree based on the full-length 16S rRNA genes (A) and 31 conserved single-copy genes (B) showing the phylogenetic position.

Proportion of 16S rRNA gene sequences in each category of phylogenetic novelty relative to cultures for each environment, by amplicons, metagenomes (without.

Characterization of the butyrate-producing community in samples derived from healthy individuals of nine metagenomic studies (I to IX; n = 826). Characterization.

Relationship between Genotype and Phenotype

Fig. 4. transparent encodes Mpv17.(A) tra maps to chromosome 20.

Sequences of two isoforms of Arhgap39/Porf-2 protein in mouse.

Genomic organization of the fruBKA locus in Escherichia coli K-12 and Pseudomonas putida KT2440 and structure of the Cra binding site. Genomic organization.

Amino acid sequence homology between XLMO-2 and the mouse, human and zebrafish homologs. Amino acid sequence homology between XLMO-2 and the mouse, human.

Relative expression of genes involved in the conversion of xylose and lactate to MCFA. Expression levels of key enzymes involved in (A) utilization of.

Assessment of plasmid lateral transfer between representative B

MLST analysis of Bacillus strains of this study and related species of the B. cereus sensu lato group. MLST analysis of Bacillus strains of this study.

Comparison of species and function profiles with ultradeep sequencing data. Comparison of species and function profiles with ultradeep sequencing data.

Sequence variation of 16S rRNA gene primer-binding sites.

Comparison of gut microbiota alpha diversity in different preservatives based on 16S rRNA gene V3-V4 amplicon sequencing. Comparison of gut microbiota.

Venn diagram of core gene overlap of the Tannerella species.

Distribution of the diversity numbers of antibiotic resistance and virulence factor protein families by environmental metagenomes’ protein family richness.

Methanogenesis Current Biology

Four Levels of Protein Structure

Phylogenetic positions of the Fe hydrogenases of termite gut symbionts

Intersections of B12 and folate metabolism, the methionine cycle, folate cycle, and DNA synthesis showing the methyl folate “trap.” The key intersection.

Two organelles in comparison.

General overview of the bioinformatic pipelines for the 16S rRNA gene microbial profiling and shotgun metagenomics. General overview of the bioinformatic.

Comparison of the van gene clusters.

Selected metabolic features of the unFirm_1 phylotype as inferred from genome and proteome comparisons. Selected metabolic features of the unFirm_1 phylotype.

Association between genome size and the dN/dS ratio for archaeal (A; n = 21) and bacterial (B; n = 28) genome pairs and association between coding density.

Relative abundance and expression of the 10 most abundant MAGs in the bioreactor at day 96. Relative abundance and expression of the 10 most abundant MAGs.

Presentation transcript:

The acetyl-CoA synthase/carbon monoxide dehydrogenase (Acs) operon gene organization of unFirm_1 and comparisons with sequenced acetogen genomes (a) and biogas metagenomic data (b). The acetyl-CoA synthase/carbon monoxide dehydrogenase (Acs) operon gene organization of unFirm_1 and comparisons with sequenced acetogen genomes (a) and biogas metagenomic data (b). Values next to the gene names in panel b correspond to the amino acid sequence identities between gene representatives from unFirm_1 and each contig determined by BLASTP. Sequence identifiers from NCBI and, if available, IMG sequence identifiers are provided for each gene/contig. Genes and products: acsA, carbon monoxide dehydrogenase/actyl-CoA synthase beta subunit; acsB, carbon monoxide dehydrogenase/actyl-CoA synthase alpha subunit; acsC, corrinoid/Fe-S protein large subunit; acsD, corrinoid/Fe-S protein SSU; acsE, methyl-tetrahydrofolate methyltransferase; metV, methylene-tetrahydrofolate reductase A; metF, methylene-tetrahydrofolate reductase B; orf7, ferredoxin; hdr, heterodisulfide reductase; cooC, carbon monoxide dehydrogenase chaperone; hydD, hydrogenase; etf, electron transfer avoprotein; fthfs, formyl-tetrahydrofolate synthase. J. A. Frank et al. mSystems 2016; doi:10.1128/mSystems.00092-16