Protein Synthesis Using DNA to Make Proteins

Slides:



Advertisements
Similar presentations
Regents Biology Turn in DNA letter  Begin reading Analogy Story and answer the questions  Don’t worry about the back page.
Advertisements

Protein Synthesis Making Proteins
DNA, RNA, and Protein Section Objectives: By the end of this section of notes your should be able to: Relate the concept of the gene to the sequence of.
Regents Biology Protein Synthesis Making Proteins.
Protein Synthesis Chapter 11.
Transcription.
DNA RNA PROTEIN TRAIT Transcription & Translation Chapter 10.
Protein Synthesis Making Proteins  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA.
Protein Synthesis Making Proteins
The Central Dogma Replication-> Transcription-> Translation Modified from Kim Foglia.
RNA & Protein Synthesis.
RNA and Protein Synthesis
Protein Synthesis Process that makes proteins
Relate the concept of the gene to the sequence of nucleotides in DNA.
RNA and Protein Synthesis Ribonucleic acid: another type of nucleic acid that works with DNA to make proteins.
CH : DNA, RNA, and Protein Section Objectives: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved.
Protein Synthesis.
Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.
Chapter 8: From DNA to Protein Section Transcription
Structure of DNA DNA is made up of a long chain of nucleotides
Regents Biology From gene to protein: transcription translation protein.
Protein Synthesis Making Proteins
What is DNA? What does it do? DNA The Genetic Material Chapter 12: DNA.
Protein Synthesis Making Proteins DNAmRNA tRNA Protein.
Genetics.
Protein Synthesis DNA Gene mRN tRNA Amino Acid Protein Nucleus
Get out worksheet from yesterday and Nucleotides
From gene to protein DNA mRNA protein trait nucleus cytoplasm
DNA Replication.
Protein Synthesis Making Proteins
Structure and Role of DNA
RNA.
How to Make a Protein?.
Protein Synthesis.
Protein Synthesis.
Do Now: Imagine you have an original Michaelangelo painting
Transcription and Translation Video Notes
Protein Synthesis.
From Gene to Protein.
Transcription and Translation
Chapter 12: From Genes to Proteins
Amino Acid Activation And Translation.
Protein Synthesis Making Proteins
from nucleic acid language to amino acid language
Protein Synthesis Making Proteins
Protein Synthesis: An Overview
Protein Synthesis Making Proteins
January 11, 2018 Objective: Journal:
Protein Synthesis RNA.
RNA: Structures and Functions
Protein Synthesis Making Proteins
DNA Transcription and Translation
Protein Synthesis RNA.
DO NOW.
Protein Synthesis.
Steps of Translation.
Genetics: A whole new look at “who’s who.”
How does DNA create action?
Do Now: Imagine you have an original Michaelangelo painting
Transcription and Translation
Protein Synthesis Genes: They’re all about ‘dem Proteins!
DNA Replication Living Environment 2015.
Protein Synthesis - Making Proteins
Enter Date Aim: Making Proteins Warm-up: HW:.
Protein Synthesis.
Protein Synthesis.
Big Q: What role does the ribosome play in assembling proteins?
Protein Synthesis: An Overview
Protein Synthesis Making Proteins
from nucleic acid language to amino acid language to PROTEIN language
Presentation transcript:

Protein Synthesis Using DNA to Make Proteins

From gene to protein protein transcription translation

Bodies  Cells  DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA

DNA  Cells  Bodies How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA

DNA  Proteins  Cells  Bodies DNA has the information to build proteins Gene- section of DNA that codes for a specific protein proteins cells DNA gets all the glory, Proteins do all the work bodies

How do proteins do all the work? proteins run living organisms a) enzymes control all chemical reactions in living organisms b) structure all living organisms are built out of proteins

Cell organization: A) DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus

Cell organization: B) Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome cytoplasm nucleus build proteins ribosome

Passing on DNA information Need to get genetic information from nucleus (DNA) to cytoplasm need a copy of DNA = messenger RNA cytoplasm nucleus build proteins mRNA ribosome

From nucleus to cytoplasm transcription DNA mRNA protein translation cytoplasm trait nucleus

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

Three Types of RNA:

Transcription: making RNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme used RNA polymerase

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Double stranded DNA unzips using RNA polymerase T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Match RNA bases to a portion of DNA bases on one side of DNA Uses RNA polymerase C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

mRNA is made one nucleotide at a time, following base pairing rules

How does mRNA code for proteins? mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How?

The mRNA code Each codon codes for one amino acid Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

Protein Synthesis animation aa From gene to protein Protein Synthesis animation transcription translation DNA mRNA protein ribosome U C A G cytoplasm trait nucleus

cytoplasm protein transcription translation nucleus trait

Protein Synthesis Video-