Protein Synthesis Using DNA to Make Proteins

From gene to protein protein transcription translation

Bodies  Cells  DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA

DNA  Cells  Bodies How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA

DNA  Proteins  Cells  Bodies DNA has the information to build proteins Gene- section of DNA that codes for a specific protein proteins cells DNA gets all the glory, Proteins do all the work bodies

How do proteins do all the work? proteins run living organisms a) enzymes control all chemical reactions in living organisms b) structure all living organisms are built out of proteins

Cell organization: A) DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus

Cell organization: B) Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome cytoplasm nucleus build proteins ribosome

Passing on DNA information Need to get genetic information from nucleus (DNA) to cytoplasm need a copy of DNA = messenger RNA cytoplasm nucleus build proteins mRNA ribosome

From nucleus to cytoplasm transcription DNA mRNA protein translation cytoplasm trait nucleus

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

Three Types of RNA:

Transcription: making RNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme used RNA polymerase

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Double stranded DNA unzips using RNA polymerase T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Match RNA bases to a portion of DNA bases on one side of DNA Uses RNA polymerase C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

mRNA is made one nucleotide at a time, following base pairing rules

How does mRNA code for proteins? mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How?

The mRNA code Each codon codes for one amino acid Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

Protein Synthesis animation aa From gene to protein Protein Synthesis animation transcription translation DNA mRNA protein ribosome U C A G cytoplasm trait nucleus

cytoplasm protein transcription translation nucleus trait

Protein Synthesis Video-