Beatriz Garcillán, MS, Marina S

Slides:

Advertisements

Similar presentations

Ana V. Marin, MSc, Anaïs Jiménez-Reinoso, MSc, Alejandro C

Advertisements

Vitamin D3 treatment of vitamin D–insufficient asthmatic patients does not alter immune cell function Brandy Reid, MS, Pierre-Olivier Girodet, MD, PhD,

Defective calcium signaling and disrupted CD20–B-cell receptor dissociation in patients with common variable immunodeficiency disorders Annick A.J.M.

Expression of IL-9 receptor α chain on human germinal center B cells modulates IgE secretion Lama M. Fawaz, PhD, Ehssan Sharif-Askari, PhD, Oumnia Hajoui,

Topical application of a vitamin D3 analogue and corticosteroid to psoriasis plaques decreases skin infiltration of TH17 cells and their ex vivo expansion

Flow cytometry imaging identifies rare TH2 cells expressing thymic stromal lymphopoietin receptor in a “proallergic” milieu Amanda J. Reefer, MS, Kathryn.

Reduced TH1/TH17 CD4 T-cell numbers are associated with impaired purified protein derivative–specific cytokine responses in patients with HIV-1 infection

A case of partial dedicator of cytokinesis 8 deficiency with altered effector phenotype and impaired CD8+ and natural killer cell cytotoxicity Raquel.

Reduced IFN-γ receptor expression and attenuated IFN-γ response by dendritic cells in patients with atopic dermatitis Eva Gros, MSc, Susanne Petzold,

CD4+ T cells in patients with chronic inflammatory rheumatic disorders show distinct levels of exhaustion Theresa Frenz, PhD, Elena Grabski, PhD, Daniela.

Immunologic defects in 22q11.2 deletion syndrome

Penicillium marneffei infection and impaired IFN-γ immunity in humans with autosomal- dominant gain-of-phosphorylation STAT1 mutations Pamela P.W. Lee,

Anti–IL-5 (mepolizumab) therapy reduces eosinophil activation ex vivo and increases IL- 5 and IL-5 receptor levels Miguel L. Stein, MD, Joyce M. Villanueva,

Assessing basophil activation by using flow cytometry and mass cytometry in blood stored 24 hours before analysis Kaori Mukai, PhD, Nicolas Gaudenzio,

Topical application of a vitamin D3 analogue and corticosteroid to psoriasis plaques decreases skin infiltration of TH17 cells and their ex vivo expansion

Type 2 innate lymphoid cells in induced sputum from children with severe asthma Prasad Nagakumar, MBBS, Laura Denney, PhD, Louise Fleming, MD, Andrew.

Identification of a subset of human natural killer cells expressing high levels of programmed death 1: A phenotypic and functional characterization Silvia.

Defects in lymphocyte telomere homeostasis contribute to cellular immune phenotype in patients with cartilage-hair hypoplasia Geraldine Aubert, PhD,

Type 3 innate lymphoid cells induce proliferation of CD94+ natural killer cells Shuo Li, PhD, Hideaki Morita, MD, PhD, Beate Rückert, Sci Tec, Tadech.

The BLNK adaptor protein has a nonredundant role in human B-cell differentiation Chantal Lagresle-Peyrou, PhD, Michèle Millili, Sonia Luce, Annie Boned,

Expression of functional leukotriene B4 receptors on human airway smooth muscle cells Satoko Watanabe, BS, Akira Yamasaki, MD, PhD, Kiyoshi Hashimoto,

Flow cytometric measurement of STAT1 and STAT3 phosphorylation in CD4+ and CD8+ T cells—clinical applications in primary immunodeficiency diagnostics

Severe atopic dermatitis is characterized by selective expansion of circulating TH2/TC2 and TH22/TC22, but not TH17/TC17, cells within the skin-homing.

Shared and restricted T-cell receptor use is crucial for carbamazepine-induced Stevens- Johnson syndrome Tai-Ming Ko, MS, Wen-Hung Chung, MD, PhD, Chun-Yu.

Induction of IL-10–producing regulatory T cells with TCR diversity by epitope-specific immunotherapy in pollinosis Kei-ichi Yamanaka, MD, Atsushi Yuta,

Human IL-31 is induced by IL-4 and promotes TH2-driven inflammation

Vitamin D3 treatment of vitamin D–insufficient asthmatic patients does not alter immune cell function Brandy Reid, MS, Pierre-Olivier Girodet, MD, PhD,

Miriam Wittmann, MD, Jana Zeitvogel, Dong Wang, MD, Thomas Werfel, MD

Kathleen R. Bartemes, BA, Gail M. Kephart, BS, Stephanie J

T-cell receptor diversity is selectively skewed in T-cell populations of patients with Wiskott-Aldrich syndrome Junfeng Wu, MD, Dawei Liu, MS, Wenwei.

CD94/NKG2C is a killer effector molecule in patients with Stevens-Johnson syndrome and toxic epidermal necrolysis Esther Morel, PhD, Salvador Escamochero,

Differential expression of functional chemokine receptors on human blood and lung group 2 innate lymphoid cells Cathryn A. Weston, PhD, Batika M.J. Rana,

Katherine G. MacDonald, BSc, Nicholas A. J

Targeting Fel d 1 to FcγRI induces a novel variation of the TH2 response in subjects with cat allergy Kathryn E. Hulse, BS, Amanda J. Reefer, MS, Victor.

T-box 21 transcription factor is responsible for distorted TH2 differentiation in human peripheral CD4+ T cells Osamu Kaminuma, DVM, PhD, Fujiko Kitamura,

Toll-like receptor 9, transmembrane activator and calcium-modulating cyclophilin ligand interactor, and CD40 synergize in causing B-cell activation Esra.

Targeting allergen to FcγRI reveals a novel TH2 regulatory pathway linked to thymic stromal lymphopoietin receptor Kathryn E. Hulse, PhD, Amanda J. Reefer,

Patients with atopic dermatitis and history of eczema herpeticum elicit herpes simplex virus–specific type 2 immune responses Stephan Traidl, Petra Kienlin,

Benjamin T. Prince, MD, Msci, Ashley L. Devonshire, MD, MPH, Kristin A

Role of hyaluronan and hyaluronan-binding proteins in human asthma

Impaired natural killer cell functions in patients with signal transducer and activator of transcription 1 (STAT1) gain-of-function mutations Giovanna.

A peptide derived from the Wiskott-Aldrich syndrome (WAS) protein-interacting protein (WIP) restores WAS protein level and actin cytoskeleton reorganization.

Anaïs Jiménez-Reinoso, PhD, Ana V

Transmembrane activator and calcium-modulating cyclophilin ligand interactor mutations in common variable immunodeficiency: Clinical and immunologic outcomes.

Ana V. Marin, MSc, Anaïs Jiménez-Reinoso, MSc, Alejandro C

T-bet inhibits innate lymphoid cell–mediated eosinophilic airway inflammation by suppressing IL-9 production Ayako Matsuki, MD, Hiroaki Takatori, MD,

T-bet inhibits innate lymphoid cell–mediated eosinophilic airway inflammation by suppressing IL-9 production Ayako Matsuki, MD, Hiroaki Takatori, MD,

Expression of IL-9 receptor α chain on human germinal center B cells modulates IgE secretion Lama M. Fawaz, PhD, Ehssan Sharif-Askari, PhD, Oumnia Hajoui,

Bruton's tyrosine kinase is not essential for LPS-induced activation of human monocytes Rebeca Pérez de Diego, PhD, Eduardo López-Granados, MD, PhD,

Cell surface characterization of T lymphocytes and allergen-specific T cell clones: Correlation of CD26 expression with T H1 subsets Martin Willheim,

Increased activation-induced cell death of high IFN-γ–producing TH1 cells as a mechanism of TH2 predominance in atopic diseases Tunc Akkoc, PhD, Pieter.

Characterization of ζ-associated protein, 70 kd (ZAP70)–deficient human lymphocytes Chaim M. Roifman, MD, Harjit Dadi, PhD, Raz Somech, MD, Amit Nahum,

Oktay Kirak, MD, Gert Riethmüller, MD

Impaired intestinal tolerance in the absence of a functional complement system Pirkka T. Pekkarinen, MD, Kirsi Vaali, PhD, Hanna Jarva, MD, PhD, Eliisa.

Allergen-specific CD8+ T cells in peanut-allergic individuals

Persistence of natural killer cells with expansion of a hypofunctional CD56−CD16+KIR+NKG2C+ subset in a patient with atypical Janus kinase 3–deficient.

Matthew J. Loza, PhD, Susan Foster, PhD, Stephen P

Sara Paveglio, PhD, MS, Erin Bennett, MS, Kelly L. Hawley, PhD, Adam P

Allergen-specific immunotherapy modulates the balance of circulating Tfh and Tfr cells Véronique Schulten, PhD, Victoria Tripple, BSc, Grégory Seumois,

IL-10/Janus kinase/signal transducer and activator of transcription 3 signaling dysregulates Bim expression in autoimmune lymphoproliferative syndrome

CCL17/thymus and activation-regulated chemokine induces calcitonin gene–related peptide in human airway epithelial cells through CCR4 Kandace Bonner,

Wasp venom immunotherapy expands a subpopulation of CD4+CD25+ forkhead box protein 3–positive regulatory T cells expressing the T-cell receptor Vβ2 and.

Regulation of IL-13 receptor α1 expression and signaling on human tonsillar B- lymphocyte subsets Oumnia Hajoui, PhD, Huaien Zheng, MD, PhD, Julie Guay,

Defective calcium signaling and disrupted CD20–B-cell receptor dissociation in patients with common variable immunodeficiency disorders Annick A.J.M.

CD25 deficiency causes an immune dysregulation, polyendocrinopathy, enteropathy, X- linked–like syndrome, and defective IL-10 expression from CD4 lymphocytes

IgG4 production is confined to human IL-10–producing regulatory B cells that suppress antigen-specific immune responses Willem van de Veen, MSc, Barbara.

Common variable immunodeficiency is associated with a functional deficiency of invariant natural killer T cells Yifang Gao, PhD, Sarita Workman, MSc,

Hematopoietic stem cell transplantation for CD3δ deficiency

CCL17/thymus and activation-regulated chemokine induces calcitonin gene–related peptide in human airway epithelial cells through CCR4 Kandace Bonner,

Invariant natural killer T cells from children with versus without food allergy exhibit differential responsiveness to milk-derived sphingomyelin Soma.

Presentation transcript:

Enrichment of the rare CD4+ γδ T-cell subset in patients with atypical CD3δ deficiency Beatriz Garcillán, MS, Marina S. Mazariegos, MS, Paul Fisch, MD, PhD, Pieter C. Res, PhD, Miguel Muñoz-Ruiz, MS, Juana Gil, MD, PhD, Eduardo López-Granados, MD, PhD, Edgar Fernández-Malavé, PhD, José R. Regueiro, PhD Journal of Allergy and Clinical Immunology Volume 133, Issue 4, Pages 1205-1208.e9 (April 2014) DOI: 10.1016/j.jaci.2013.10.002 Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

Fig 1 T-lymphocyte analyses in 2 patients with atypical CD3δ deficiency. A, Absolute αβ and γδ (top) and DN, CD8+, and CD4+ γδ (bottom) T-cell numbers (mean ± SD) in comparison with the normal age-matched distribution in percentiles. B, γδ T-cell repertoire analysis by Vδ CDR3 length profiling. Abscissae are base pairs as indicated. Ordinates are peak heights. TCRD spectratyping is very variable in controls (see Fig E1 for further examples) but can be used to exclude clonal γδ T-cell expansions. C, TCRγδ+ cell distribution between CD4− and CD4+ subsets (upper quadrants). DN, Double negative. Journal of Allergy and Clinical Immunology 2014 133, 1205-1208.e9DOI: (10.1016/j.jaci.2013.10.002) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

Fig 2 Comparative phenotypic and functional characteristics of γδ CD4+ versus CD4− T cells. A, Surface CD3 (and CD4) expression. αβ T cells are shown for reference. Similar results for AIII.1 (not shown) and with TCR-specific mAb.4 Numbers are control/patient MFI ratios. Vertical lines indicate background staining. B, Expression of activation markers. C, Cultured γδ T-cell activation (% CD69+ cells 24 hours after stimulation). MFI, Mean fluorescence intensity. Journal of Allergy and Clinical Immunology 2014 133, 1205-1208.e9DOI: (10.1016/j.jaci.2013.10.002) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

Fig E1 γδ T-cell repertoire analysis by Vδ CDR3 length profiling in 3 unrelated normal controls, to illustrate the variability of TCRD spectratyping. Abscissae are base pairs as indicated. Ordinates are peak heights. The orange peaks along abscissae are molecular weight standards. Journal of Allergy and Clinical Immunology 2014 133, 1205-1208.e9DOI: (10.1016/j.jaci.2013.10.002) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

Fig E2 Relative αβ and γδ T-cell numbers (top) and DN, CD8+, and CD4+ γδ T-cell numbers (bottom). DN, Double negative. Journal of Allergy and Clinical Immunology 2014 133, 1205-1208.e9DOI: (10.1016/j.jaci.2013.10.002) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

Fig E3 Phenotypical characterization of cultured γδ T cells. A, TCRγδ+ cell distribution between CD4− and CD4+ subsets (upper quadrants). B, Vδ1, Vδ2, and Vγ9 usage within CD4+ or CD4− γδ T-cell subsets. C, Intracellular CD3δ levels detected in permeabilized T cells by using APA1/2 after gating for TCRαβ or TCRγδ, respectively. The vertical lines indicate the upper limit staining of the isotype control. The numbers in each histogram indicate control/patient MFI ratios. MFI, Mean fluorescence intensity. Journal of Allergy and Clinical Immunology 2014 133, 1205-1208.e9DOI: (10.1016/j.jaci.2013.10.002) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

Fig E4 γδ T-cell subsets in human CD3γ deficiency.E1 The numbers indicate the TCRγδ+ cell distribution between the CD4− and CD4+ subsets (upper quadrants) in fresh PBMCs compared with a control. Journal of Allergy and Clinical Immunology 2014 133, 1205-1208.e9DOI: (10.1016/j.jaci.2013.10.002) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

Fig E5 CD3δ KD in primary T cells. A, PBMCs from healthy donors were infected with lentiviruses carrying shRNA for CD3δ (GAGGACAGAGTGTTTGTGAAT) or no shRNA (empty) cloned in pLKO.1. After selection with puromycin, GFP+ cells were analyzed for surface TCR expression by using anti-CD3 mAb (SK7) and normalized to the empty vector (n = 2, mean ± SD). αβ T cells were gated as TCRαβ+ (IP26) and γδ T cells as TCRγδ+ (IMMU510). B, KD specificity was ascertained in permeabilized samples by flow cytometry using CD3δ-specific or, as a negative control, CD3γ-specific mAb to probe for intracellular CD3 expression (iCD3δ [EPR4426] and iCD3γ [EPR4517] from Abcam). The numbers in each histogram indicate empty/shCD3δ MFI ratios. KD, Knock down; MFI, mean fluorescence intensity. Journal of Allergy and Clinical Immunology 2014 133, 1205-1208.e9DOI: (10.1016/j.jaci.2013.10.002) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions

Fig E6 Heterogeneous surface TCR levels in γδ versus αβ T cells. Anti-CD3 mAb (SK7) MFI is represented within gated αβ (IP26+) and γδ (IMMU510+) T cells from 39 different healthy donors. In addition to the reported higher surface TCR MFI in γδ T cells,E2 variance (S2) homogeneity was compared by using the Snedecor F distribution test with 38 and 38 degrees of freedom. MFI, Mean fluorescence intensity. Journal of Allergy and Clinical Immunology 2014 133, 1205-1208.e9DOI: (10.1016/j.jaci.2013.10.002) Copyright © 2013 American Academy of Allergy, Asthma & Immunology Terms and Conditions