Erythropoietin gene from a teleost fish, Fugu rubripes

Slides:

Advertisements

Similar presentations

Figure 1. RT–PCR identification of an abnormal transcript of the PTPN6 gene in normal and leukemic bone marrow cells and cell line. (a) Diagrammatic representation.

Advertisements

MLANA/MART1 and SILV/PMEL17/GP100 Are Transcriptionally Regulated by MITF in Melanocytes and Melanoma Jinyan Du, Arlo J. Miller, Hans R. Widlund, Martin.

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A by Richard D. Bagnall, Naushin Waseem, Peter M.

by Elena A. Federzoni, Peter J. M. Valk, Bruce E

REDK, a novel human regulatory erythroid kinase

Characterization of the Human Platelet/Endothelial Cell Adhesion Molecule-1 Promoter: Identification of a GATA-2 Binding Element Required for Optimal Transcriptional.

by Jian-Min Wang, Hong Zheng, Mila Blaivas, and Kotoku Kurachi

Alternative Splicing of a Novel Glycophorin Allele GPHe(GL) Generates Two Protein Isoforms in the Human Erythrocyte Membrane by Cheng-Han Huang, Olga O.

C-myb Transactivates the Human Cyclin A1 Promoter and Induces Cyclin A1 Gene Expression by Carsten Müller, Rong Yang, Gregory Idos, Nicola Tidow, Sven.

by Madhu Gupta, Paul T. Mungai, and Eugene Goldwasser

The Role of Transcription Factor PU

Crucial Roles of MZF1 and Sp1 in the Transcriptional Regulation of the Peptidylarginine Deiminase Type I Gene (PADI1) in Human Keratinocytes Sijun Dong,

Follicular lymphoma with a novel t(14;18) breakpoint involving the immunoglobulin heavy chain switch mu region indicates an origin from germinal center.

by Hong Hao, Huiling Qi, and Manohar Ratnam

CD74 induces TAp63 expression leading to B-cell survival

Volume 28, Issue 3, Pages (November 2007)

Skin-Specific Expression of ank-393, a Novel Ankyrin-3 Splice Variant

by Takashi Kasukabe, Junko Okabe-Kado, and Yoshio Honma

Regulation of expression of murine transferrin receptor 2

In Vivo Expression of Murine Platelet Glycoprotein Ibα

by Wen-feng Xu, Zhi-wei Xie, Dominic W. Chung, and Earl W. Davie

by Sanjai Sharma, and Alan Lichtenstein

The function of the bcl-x promoter in erythroid progenitor cells

Congenital afibrinogenemia: mutations leading to premature termination codons in fibrinogen Aα-chain gene are not associated with the decay of the mutant.

High incidence of somatic mutations in the AML1/RUNX1 gene in myelodysplastic syndrome and low blast percentage myeloid leukemia with myelodysplasia by.

Analysis of the Human Ferrochelatase Promoter in Transgenic Mice

The (4;11)(q21;p15) Translocation Fuses the NUP98 andRAP1GDS1 Genes and Is Recurrent in T-Cell Acute Lymphocytic Leukemia by Damian J. Hussey, Mario Nicola,

by Shrikanth P. Hegde, JingFeng Zhao, Richard A. Ashmun, and Linda H

Marco Baralle, Tibor Pastor, Erica Bussani, Franco Pagani

by Kwang-Hyun Baek, Michelle A

Deletion-based mechanisms of Notch1 activation in T-ALL: key roles for RAG recombinase and a conserved internal translational start site in Notch1 by Todd.

IFN-γ Upregulates Expression of the Mouse Complement C1rA Gene in Keratinocytes via IFN-Regulatory Factor-1 Sung June Byun, Ik-Soo Jeon, Hyangkyu Lee,

The interferon regulatory factor ICSBP/IRF-8 in combination with PU

Volume 136, Issue 2, Pages (February 2009)

Rat mesangial α-endosulfine

by Laura J. Norton, Alister P. W

Exon Circularization Requires Canonical Splice Signals

Volume 10, Issue 2, Pages (February 1999)

Posttranslational Regulation of Ca2+-Activated K+ Currents by a Target-Derived Factor in Developing Parasympathetic Neurons Priya Subramony, Sanja Raucher,

Identification and differential expression of human collagenase-3 mRNA species derived from internal deletion, alternative splicing, and different polyadenylation.

Identification, description, and expression of E7-less STING isoforms.

Volume 18, Issue 2, Pages (April 2005)

Identification of COL7A1 Alternative Splicing Inserting 9 Amino Acid Residues Into the Fibronectin Type III Linker Domain Daisuke Sawamura, Maki Goto,

Hiroaki Matsunami, Linda B Buck Cell

Membrane type-1 matrix metalloproteinase is induced following cyclic compression of in vitro grown bovine chondrocytes J.N.A. De Croos, Ph.D., B. Jang,

Sex-Linked period Genes in the Silkmoth, Antheraea pernyi

Volume 134, Issue 1, Pages (January 2008)

Alternative Splicing in the α-Galactosidase A Gene: Increased Exon Inclusion Results in the Fabry Cardiac Phenotype Satoshi Ishii, Shoichiro Nakao, Reiko.

Epigenetic Control of the S100A6 (Calcyclin) Gene Expression

Volume 21, Issue 6, Pages (December 2004)

APOE Gene Targeting (A) Schematic representation of the endogenous APOE locus, the gene targeting vector and the targeted APOE locus. The exons of the.

Volume 39, Issue 5, Pages (November 2003)

Cloning of a novel gene in the human kidney homologous to rat munc13s: Its potential role in diabetic nephropathy Yong Song, Menachem Ailenberg, Mel.

Assessing the Functional Characteristics of Synonymous and Nonsynonymous Mutation Candidates by Use of Large DNA Constructs A.M. Eeds, D. Mortlock, R.

Accurate, simple, and inexpensive assays to diagnose F8 gene inversion mutations in hemophilia A patients and carriers by Debargh Dutta, Devi Gunasekera,

Volume 116, Issue 2, Pages (February 1999)

The Gene Mutated in Variant Late-Infantile Neuronal Ceroid Lipofuscinosis (CLN6) and in nclf Mutant Mice Encodes a Novel Predicted Transmembrane Protein

Volume 18, Issue 9, Pages (September 2010)

The Effect of Distance on Long-Range Chromatin Interactions

Volume 21, Issue 6, Pages (December 2004)

Identification of Skn-1n, a Splice Variant Induced by High Calcium Concentration and Specifically Expressed in Normal Human Keratinocytes Koji Nakajima,

Expression of multiple forms of MEL1 gene products.

Genomewide Association Analysis of Human Narcolepsy and a New Resistance Gene Minae Kawashima, Gen Tamiya, Akira Oka, Hirohiko Hohjoh, Takeo Juji, Takashi.

Jiamiao Lu, Feijie Zhang, Mark A Kay Molecular Therapy

Mutation of the Ca2+ Channel β Subunit Gene Cchb4 Is Associated with Ataxia and Seizures in the Lethargic (lh) Mouse Daniel L Burgess, Julie M Jones,

Loss-of-Function Mutations in a Human Gene Related to Chlamydomonas reinhardtii Dynein IC78 Result in Primary Ciliary Dyskinesia Gaëlle Pennarun, Estelle.

Exon Skipping in IVD RNA Processing in Isovaleric Acidemia Caused by Point Mutations in the Coding Region of the IVD Gene Jerry Vockley, Peter K. Rogan,

Fang Wang, Yunfeng Wang, Jie Ding, Jiyun Yang Kidney International

Characterization of Human FAST-1, a TGFβ and Activin Signal Transducer

Presentation transcript:

Erythropoietin gene from a teleost fish, Fugu rubripes by Chih-Fong Chou, Sumanty Tohari, Sydney Brenner, and Byrappa Venkatesh Blood Volume 104(5):1498-1503 September 1, 2004 ©2004 by American Society of Hematology

Comparisons of the Fugu and human Epo loci. Comparisons of the Fugu and human Epo loci. (A) The transcription start site is shown by an arrow. Exons are shown as rectangles and introns shown as thin lines. The sizes of introns are shown. (B) Genes are shown as arrows, with the syntenic genes shown as filled arrows. The gene order at the human locus on Chr7 was obtained from the UCSC Human Genome Browser (http://genome.ucsc.edu). The human gene for 2700038N03Rik was identified in this study. Chih-Fong Chou et al. Blood 2004;104:1498-1503 ©2004 by American Society of Hematology

The hydrophilicity plots for Epos from Fugu, human, horse, pig, and rat generated using Kyte & Doolittle hydrophilicity parameters. The hydrophilicity plots for Epos from Fugu, human, horse, pig, and rat generated using Kyte & Doolittle hydrophilicity parameters. The location of the N-terminal amino acid residue of the signal peptide is shown. aa indicates amino acid. Chih-Fong Chou et al. Blood 2004;104:1498-1503 ©2004 by American Society of Hematology

Expression pattern of the Fugu Epo gene. Expression pattern of the Fugu Epo gene. (A) RT-PCR analysis. The Fugu Epo cDNA (fEpo) was amplified by RT-PCR using primers complementary to exons 2 and 3. The kidney tissue used for RNA extraction includes the head and the tail kidney. Actin was amplified as an internal control for the quality of Fugu cDNA. (B) Northern blot analysis. Each lane contains about 20 μg (brain, heart, kidney, ovary) or 10 μg (liver) of Fugu total RNA. The Epo transcript in the brain (1.54 kb) is shorter than that in the heart and liver (1.73 kb). A larger transcript of 3.1 kb is also found in these tissues. The sequence of this transcript is not clear from the exon-intron structure of Epo predicted by us. Chih-Fong Chou et al. Blood 2004;104:1498-1503 ©2004 by American Society of Hematology

Fugu promoter analysis in a fish (top minnow) hepatoma cell line (PLHC-1). Fugu promoter analysis in a fish (top minnow) hepatoma cell line (PLHC-1). (A) Schematic representation of the luciferase (Luc) reporter gene constructs. Fugu Epo locus is shown at the top. The transcription start site is shown by an arrow. (B) The luciferase activity of pGL-basic (PGL3-basic) and pGL3-control (PGL3-SV40) vectors transfected into the PLHC-1 cell line. SV40-promoter/enhancer driven pGL3-control vector, which was used as a positive control, showed up to 115-fold increase in the luciferase activity. (C) The luciferase activity of various promoter-luciferase constructs transfected into the PLHC-1 cell line. The level of luciferase activity obtained with various fEpo promoter-luciferase constructs was significantly higher (P < .05) than that of the pGL3-basic vector. (D) The luciferase activity of the various promoter-luciferase constructs under normal conditions (control), in the presence of cobalt chloride (CoCl2), under hypoxic conditions, and under anaerobic conditions. *Significantly different from the corresponding control at P < .05. RLU indicates relative light unit. The data shown are the mean (n = 3) ± standard error of the mean. Chih-Fong Chou et al. Blood 2004;104:1498-1503 ©2004 by American Society of Hematology

Expression of Fugu Epo in PLHC-1 and HepG2 cell lines. Expression of Fugu Epo in PLHC-1 and HepG2 cell lines. An 11-kb genomic fragment of the Fugu Epo was transfected into the PLHC-1 (A) or HepG2 (B) cell lines that were cultured under normal (Control), hypoxic, or anaerobic conditions, or in the presence of cobalt chloride (CoCl2). HepG2 cells did not survive under anaerobic conditions. The expression of Fugu Epo (fEpo) was analyzed by RT-PCR. PCR was also done with an aliquot of the RNA treated with DNAse that was used to synthesize cDNA (fEpo(-RT)) to check for residual genomic DNA in the cDNA preparations. The larger fEpo band (290 bp) represents unspliced transcript and the smaller band (193 bp) the spliced transcript. Endogenous actin or human glyceraldehyde-3-phosphate dehydrogenase (hG3PDH) fragment was amplified as an internal control. Both were found to be efficiently spliced. The following primers were used to amplify hG3PDH: 5′ACCACAGTCCATGCCATCAC3′ and 5′TCCACCACCCTGTTGCTGTA3′. Chih-Fong Chou et al. Blood 2004;104:1498-1503 ©2004 by American Society of Hematology